alignShortReads: Exact alignment of DNA sequences against a reference

In R453Plus1Toolbox: A package for importing and analyzing data from Roche's Genome Sequencer System

Description

This method aligns given sequences against a given reference genome using the matchPDict method. Only exact (no errors) and unique matches are returned.

Usage

alignShortReads(object, bsGenome, seqNames, ensemblNotation)

Arguments

object	The reads that should be aligned agiven either as a DNAStringSet or a AVASet instance. In the latter case the reference sequences are extracted and aligned.
bsGenome	A bsGenome instance providing the reference sequences.
seqNames	The names of the sequences in bsGenome that should be used. If omitted, all reference sequences are used.
ensemblNotation	If set to TRUE, “chr” is removed from the reference sequences' names in the returned alignment. Default value is FALSE.

Details

All reads are aligned against the reference and its reverse complement. If the reads are not in 5' to 3' orientation, they should be reversed before. Note that only exact and unique alignments are reported. Use matchPDict directly for more flexibility.

Value

An object of class AlignedRead or a AVASet instance.

Author(s)

Hans-Ulrich Klein

See Also

matchPDict, DNAStringSet, AlignedRead, AVASet

Examples

library("BSgenome.Scerevisiae.UCSC.sacCer2")
reads = DNAStringSet(c(
  "CCGTTCAAAGAGCCCTTGGCCCATAATCCACCGGTT",
  "ATCCTGCCACAGGAGTCCATGGAGGTTTCGCCA"))
alignShortReads(reads, Scerevisiae, seqNames="chrIII")

R453Plus1Toolbox documentation built on Nov. 8, 2020, 5:59 p.m.