# readsToTarget generic -----
#'@title Trims reads to a target region.
#'@description Trims aligned reads to one or several target regions,
#'optionally reverse complementing the alignments.
#'@param reads A GAlignments object, or a character vector of the filenames
#'@param target A GRanges object specifying the range to narrow alignments to
#'@author Helen Lindsay
#'@rdname readsToTarget
#'
#'@import methods
#'@import BiocParallel
#'@import Biostrings
#'@import ggplot2
#'@import GenomicAlignments
#'@import GenomicRanges
#'@import IRanges
#'@import Rsamtools
#'@import S4Vectors
#'@importFrom grDevices colorRampPalette
#'@importFrom grid gpar grid.rect
#'@importFrom gridExtra grid.arrange arrangeGrob
#'@importFrom reshape2 melt
#'@importFrom AnnotationDbi select
#'@importFrom GenomeInfoDb seqlengths
#'@importFrom utils modifyList
#'@export
setGeneric("readsToTarget", function(reads, target, ...) {
standardGeneric("readsToTarget")})
# -----
# readsToTarget GAlignments, GRanges -----
#'@param name An experiment name for the reads. (Default: NULL)
#'@param reverse.complement (Default: TRUE) Should the alignments be
#' oriented to match the strand of the target? If TRUE, targets located
# on the postive strand are displayed with respect to the postive
#' strand and targets on the negative strand with respect to the
#' negative strand. If FALSE, the parameter 'orientation' must be set
#' to determine the orientation.
#' 'reverse.complement' will be replaced by 'orientation' in a later release.
#'@param collapse.pairs If reads are paired, should pairs be collapsed?
#' (Default: FALSE) Note: only collapses primary alignments,
#' and assumes that there is only one primary alignment per read.
# May fail with blat alignments converted to bam.
#'@param use.consensus Take the consensus sequence for non-matching pairs? If FALSE,
#'the sequence of the first read is used. Can be very slow. (Default: FALSE)
#'@param store.chimeras Should chimeric reads be stored? (Default: FALSE)
#'@param orientation One of "target" (reads are displayed on the same
#' strand as the target) "opposite" (reads are displayed on the opposite)
#' strand from the target or "positive" (reads are displayed on the forward
#' strand regardless of the strand of the target) (Default:"target")
#'@param verbose Print progress and statistics (Default: TRUE)
#'@param minoverlap Minimum number of bases the aligned read must
#' share with the target site. If not specified, the aligned
#' read must completely span the target region. (Default: NULL)
#'@return (signature("GAlignments", "GRanges")) A \code{\link{CrisprRun}} object
#'@examples
#'# Load the metadata table
#'md_fname <- system.file("extdata", "gol_F1_metadata_small.txt", package = "CrispRVariants")
#'md <- read.table(md_fname, sep = "\t", stringsAsFactors = FALSE)
#'
#'# Get bam filenames and their full paths
#'bam_fnames <- sapply(md$bam.filename, function(fn){
#' system.file("extdata", fn, package = "CrispRVariants")})
#'
#'reference <- Biostrings::DNAString("GGTCTCTCGCAGGATGTTGCTGG")
#'gd <- GenomicRanges::GRanges("18", IRanges::IRanges(4647377, 4647399),
#' strand = "+")
#'
#'crispr_set <- readsToTarget(bam_fnames, target = gd, reference = reference,
#' names = md$experiment.name, target.loc = 17)
#'
#'@rdname readsToTarget
setMethod("readsToTarget", signature("GAlignments", "GRanges"),
function(reads, target, ..., reverse.complement = TRUE,
chimeras = NULL, collapse.pairs = FALSE,
use.consensus = FALSE, store.chimeras = FALSE,
verbose = TRUE, name = NULL, minoverlap = NULL,
orientation = c("target","opposite","positive")){
orientation <- match.arg(orientation)
dots <- list(...)
# If calling directly rather than internally, run checks
if (! "checked" %in% names(dots) & isTRUE(dots$checked)){
.checkReadsToTarget(target, reference = NULL, target.loc = NULL,
reverse.complement, orientation,
chimeras)
.checkForPaired(reads)
}
keep.unpaired <- TRUE
if ("keep.unpaired" %in% names(dots)){
keep.unpaired <- dots["keep.unpaired"]
}
# Choose which strand to orient reads to
if (isTRUE(reverse.complement) & as.character(strand(target)) == "*"){
message(paste0("Target does not have a strand, ",
"but reverse.complement is TRUE.\n",
"Orienting reads to reference strand."))
rc = FALSE
} else {
rc <- rcAlns(as.character(strand(target)), orientation)
}
# If there are no non-chimeric reads, chimeras can still be stored
if (length(reads) == 0){
if (length(chimeras) == 0) {return(NULL)}
crun <- CrisprRun(reads, target, rc = rc,
name = name, chimeras = chimeras,
verbose = verbose)
return(crun)
}
# Check if alignments are paired and should be collapsed
if (isTRUE(collapse.pairs)){
if (is.null(names(reads)) | ! ("flag" %in% names(mcols(reads))) ){
stop("Reads must include names and bam flags for collapsing pairs")
}
}
if (is.null(chimeras)) {
chimeras <- GenomicAlignments::GAlignments()
if (isTRUE(store.chimeras)) {
# There is no way to specify tolerance here, or to use target.loc
temp <- separateChimeras(reads, target, by.flag = collapse.pairs,
verbose = verbose)
reads <- temp$bam
chimeras <- temp$chimeras[[1]]
}
}
# To do: check whether this is redundant with narrowAlignments
# Filter out reads that don't span the target region
# Not using findOverlaps because reads may be paired, i.e. names nonunique
if (is.null(minoverlap)){
bam <- reads[start(reads) <= start(target) & end(reads) >= end(target) &
seqnames(reads) == as.character(seqnames(target))]
} else { bam <- reads }
if (isTRUE(verbose)){
message(sprintf("%s of %s nonchimeric reads span the target range\n",
length(bam), length(reads)))
}
# If bam and chimeras are empty, no further calculation needed
if (length(bam) == 0 & length(chimeras) == 0) return(NULL)
if (length(bam) == 0){
crun <- CrisprRun(bam, target, rc = rc,
name = name, chimeras = chimeras, verbose = verbose)
return(crun)
}
# If bam is non-empty, orient and narrow the reads to the target
# narrow aligned reads
result <- narrowAlignments(bam, target, reverse.complement = rc,
verbose = verbose, minoverlap = minoverlap)
# Collapse pairs of narrowed reads
if (isTRUE(collapse.pairs)){
gen_ranges <- GenomicAlignments::cigarRangesAlongReferenceSpace(
cigar(result), pos = start(result))
result <- collapsePairs(result, genome.ranges = gen_ranges,
use.consensus = use.consensus,
keep.unpaired = keep.unpaired, verbose = verbose)
result <- result$alignments
}
if (length(result) == 0){
if (length(chimeras) == 0){
return(NULL)
}
crun <- CrisprRun(result, target, rc = rc, name = name,
chimeras = chimeras, verbose = verbose)
return(crun)
}
crun <- CrisprRun(result, target, rc = rc, name = name,
chimeras = chimeras, verbose = verbose)
crun
}) # -----
# readsToTarget GAlignmentsList, GRanges -----
#'@rdname readsToTarget
setMethod("readsToTarget", signature("GAlignmentsList", "GRanges"),
function(reads, target, ..., reference = reference,
names = NULL, reverse.complement = TRUE, target.loc = 17,
chimeras = NULL, collapse.pairs = FALSE, use.consensus = FALSE,
orientation = c("target","opposite","positive"),
minoverlap = NULL, verbose = TRUE){
# To do: Deal with potentially empty chimeras
orientation <- match.arg(orientation)
# Always run checks as this function is not called by others
.checkReadsToTarget(target, reference = NULL, target.loc = NULL,
reverse.complement, orientation,
chimeras)
# Check: if chimeras and reads are supplied, they should have equal length
nch <- length(chimeras)
nreads <- length(reads)
if (nreads > 0 & nch > 0 & ! nreads == nch){
stop("Chimeras must be either NULL or a GAlignmentsList ",
"of length equal to reads")
}
# Collapse pairs if required and initialise CrisprSet object
cset <- alnsToCrisprSet(reads, reference, target, reverse.complement,
collapse.pairs, names, use.consensus, target.loc,
verbose, chimeras = chimeras, minoverlap = minoverlap,
orientation = orientation, checked = TRUE, ...)
cset
}) # -----
# readsToTarget character, GRanges -----
#'@param names Experiment names for each bam file. If not supplied, filenames are used.
#'@param chimeras Flag to determine how chimeric reads are treated. One of
#'"ignore", "exclude", and "merge". Default "count", "merge" not implemented yet
#'@param reference The reference sequence
#'@param exclude.ranges Ranges to exclude from consideration, e.g. homologous to a pcr primer.
#'@param exclude.names Alignment names to exclude
#'@param ... Extra arguments for initialising CrisprSet
#'@return (signature("character", "GRanges")) A \code{\link{CrisprSet}} object
#'@rdname readsToTarget
setMethod("readsToTarget", signature("character", "GRanges"),
function(reads, target, ..., reference, reverse.complement = TRUE,
target.loc = 17, exclude.ranges = GRanges(), exclude.names = NA,
chimeras = c("count","exclude","ignore", "merge"),
collapse.pairs = FALSE, use.consensus = FALSE,
orientation = c("target","opposite","positive"),
names = NULL, minoverlap = NULL, verbose = TRUE){
# Prepare input parameters
args <- list(...)
chimeras <- match.arg(chimeras)
orientation <- match.arg(orientation)
# If reading in alignments, always run checks
.checkFnamesExist(reads)
.checkReadsToTarget(target, reference, target.loc,
reverse.complement, orientation, chimeras)
if (! class(reference) == "DNAString"){
reference <- Biostrings::DNAString(reference[[1]])
}
c_to_t <- 5
if ("chimera.to.target" %in% names(args)){
c_to_t <- args[["chimera.to.target"]]
}
# Read in the bam files, separate chimeric and non-chimeric reads
temp <- lapply(reads, readTargetBam, target = target,
exclude.ranges = exclude.ranges,
exclude.names = exclude.names,
chimeras = chimeras, by.flag = collapse.pairs,
chimera.to.target = c_to_t,
verbose = verbose)
alns <- lapply(temp, "[[", "bam")
chimeras <- lapply(temp, "[[", "chimeras")
# If names are not specified, set them to the filenames
if (is.null(names)){
names <- basename(reads)
}
names <- as.character(names)
# Collapse pairs, count insertions, create CrisprSet objects
cset <- alnsToCrisprSet(alns, reference, target, reverse.complement,
collapse.pairs, names = names,
use.consensus = use.consensus,
target.loc = target.loc, verbose = verbose,
chimeras = chimeras, minoverlap = minoverlap,
orientation = orientation, checked = TRUE, ...)
cset
}) # -----
#__________________________________________________________________
# readsToTargets (for alignments to multiple guides)
#__________________________________________________________________
# readsToTargets -----
#'@export
#'@rdname readsToTarget
setGeneric("readsToTargets", function(reads, targets, ...) {
standardGeneric("readsToTargets")})
#'@param targets A set of targets to narrow reads to
#'@param references A set of reference sequences matching the targets.
#'References for negative strand targets should be on the negative strand.
#'@param primer.ranges A set of GRanges, corresponding to the targets.
#'Read lengths are typically greater than target regions, and it can
#'be that reads span multiple targets. If primer.ranges are available,
#'they can be used to assign such reads to the correct target.
#'@param target.loc The zero point for renumbering (Default: 17)
#'@param ignore.strand Should strand be considered when finding overlaps?
#'(See \code{\link[GenomicAlignments]{findOverlaps}} )
#'@param bpparam A BiocParallel parameter for parallelising across reads.
#'Default: no parallelisation. (See \code{\link[BiocParallel]{bpparam}})
#'@param chimera.to.target Number of bases that may separate a chimeric read
#'set from the target.loc for it to be assigned to the target. (Default: 5)
#'@rdname readsToTarget
setMethod("readsToTargets", signature("character", "GRanges"),
function(reads, targets, ..., references, primer.ranges = NULL,
target.loc = 17, reverse.complement = TRUE,
collapse.pairs = FALSE, use.consensus = FALSE,
ignore.strand = TRUE, names = NULL,
bpparam = BiocParallel::SerialParam(),
orientation = c("target","opposite","positive"),
chimera.to.target = 5, verbose = TRUE){
dummy <- .checkReadsToTargets(targets, primer.ranges, references)
.checkFnamesExist(reads)
if (is.null(names)){
names <- reads
}
param <- Rsamtools::ScanBamParam(what = c("seq", "flag"))
args <- list(...)
ntargets <- length(targets)
bams <- BiocParallel::bplapply(seq_along(reads), function(i){
if (verbose) message(sprintf("Loading alignments for %s\n\n",
names[i]))
bam <- GenomicAlignments::readGAlignments(reads[i],
param = param, use.names = TRUE)
if (length(bam) == 0){
if (verbose) message("No reads in alignment\n")
return(NULL)
}
return(bam)
}, BPPARAM = bpparam)
bams <- GAlignmentsList(bams)
if (collapse.pairs == FALSE) dummy <- .checkForPaired(bams)
orientation <- match.arg(orientation)
result <- readsToTargets(bams, targets, references = references,
target.loc = target.loc, verbose = verbose,
reverse.complement = reverse.complement,
ignore.strand = ignore.strand,
collapse.pairs = collapse.pairs, names = names,
bpparam = bpparam, use.consensus = use.consensus,
chimera.to.target = chimera.to.target,
orientation = orientation)
result
})
#'@rdname readsToTarget
setMethod("readsToTargets", signature("GAlignmentsList", "GRanges"),
function(reads, targets, ..., references, primer.ranges = NULL,
target.loc = 17, reverse.complement = TRUE,
collapse.pairs = FALSE, use.consensus = FALSE,
ignore.strand = TRUE, names = NULL,
bpparam = BiocParallel::SerialParam(),
chimera.to.target = 5,
orientation = c("target", "opposite", "positive"),
verbose = TRUE){
# To do:
# Currently this returns a list with the non-empty CrisprSets
# consider making the list the length of the supplied targets
dummy <- .checkReadsToTargets(targets, primer.ranges, references)
if (collapse.pairs == FALSE) dummy <- .checkForPaired(reads)
if (is.null(names)){
if (! is.null(names(reads))){
names <- names(reads)
}else{
names <- sprintf("Sample %s",seq_along(reads))
}
}
orientation <- match.arg(orientation)
byPCR <- BiocParallel::bplapply(reads, function(bam){
if (verbose) message(sprintf("Assigning chimeric reads to targets \n"))
# Change to default: just supply the cut site (target.loc)
ch_tgts <- resize(resize(targets, target.loc + 1, fix="start"), 2, fix = "end")
temp <- separateChimeras(bam, ch_tgts, chimera.to.target,
by.flag = collapse.pairs, verbose = verbose)
bam <- temp$bam
chimerasByPCR <- temp$chimeras
# If primer.ranges are provided, match reads to primers
# If not, match reads to targets
if (! is.null(primer.ranges)){
hits <- readsByPCRPrimer(bam, primer.ranges, verbose = verbose)
splits <- split(queryHits(hits), subjectHits(hits))
} else{
hits <- findOverlaps(targets, bam, type = "within", ignore.strand = TRUE)
duplicates <- (duplicated(subjectHits(hits)) |
duplicated(subjectHits(hits), fromLast = TRUE))
if (verbose){
msg <- paste0("%s (%.2f%%) reads of %s overlap a target\n",
" %s (%.2f%%) of these overlapping multiple targets removed\n",
" %s (%.2f%%) reads mapped to a single target\n\n")
rhits <- length(unique(subjectHits(hits)))
bl <- length(bam)
ndups <- sum(duplicated(subjectHits(hits)))
nndups <- sum(!duplicates)
message(sprintf(msg, rhits, rhits/bl*100, bl, ndups, ndups/rhits*100,
nndups, nndups/bl*100))
}
hits <- hits[!duplicates]
splits <- split(subjectHits(hits), queryHits(hits))
}
bamByPCR <- as.list(rep(NA, length(targets)))
names(bamByPCR) <- seq_along(targets)
for (nm in names(splits)){
bamByPCR[[nm]] <- bam[splits[[nm]]]
}
byPCR <- list(bamByPCR = bamByPCR, chimerasByPCR = chimerasByPCR)
byPCR
}, BPPARAM = bpparam)
# Remove any empty alignments
to_keep <- which(lapply(byPCR, length) > 0)
byPCR <- byPCR[to_keep]
names <- names[to_keep]
if (length(names) == 0){
stop("No files contain on target reads")
}
# Reformat to list by guides instead of samples
tlist <- function(i) {
lapply(temp, "[[", i)
}
temp <- lapply(byPCR, "[[", "chimerasByPCR")
chimerasByPCR <- lapply(seq_along(temp[[1]]), tlist)
temp <- lapply(byPCR, "[[", "bamByPCR")
bamByPCR <- lapply(seq_along(temp[[1]]), tlist)
tg_gr <- as(targets, "GRangesList")
result <- BiocParallel::bplapply(seq_along(bamByPCR), function(i){
bams <- bamByPCR[[i]]
tgt <- tg_gr[[i]]
mcols(tgt) <- mcols(targets[i])
chs <- chimerasByPCR[[i]]
ref <- references[[i]]
if (isTRUE(verbose)){
message(sprintf("\n\nWorking on target %s\n", names(tgt)))
}
cset <- alnsToCrisprSet(bams, ref, tgt, reverse.complement,
collapse.pairs, names, use.consensus, target.loc,
verbose, chimeras = chs,
orientation = orientation, ...)
}, BPPARAM = bpparam)
if (length(result) == 0){
warning("No reads span a target")
return(result)
}
if (!is.null(names(targets))) {
names(result) <- names(targets)
}
result <- result[!sapply(result, is.null)]
result
}) # -----
#__________________________________________________________________
# Data import and processing
#__________________________________________________________________
# separateChimeras -----
separateChimeras <- function(bam, targets, tolerance = 5,
by.flag = TRUE, verbose = FALSE){
# The supplementary alignment flag must be set to distinguish paired from
# chimeric reads. Tolerance is added on both sides
# A better approach might be to explicitly consider where chimeras
# join w.r.t read
# Worth warning if there are chimeras independent of the guide?
# Find chimeras
ch_idxs <- findChimeras(bam, by.flag)
chimeras <- bam[ch_idxs]
original_ln <- length(chimeras)
# Setup return data
chimerasByPCR <- vector("list", length(targets))
names(chimerasByPCR) <- as.character(seq_along(targets))
# If the target is completely contained within one member of the
# chimeric set (two members if paired), do not count it as a chimera
guide_within <- subjectHits(findOverlaps(targets, chimeras,
ignore.strand = TRUE, type = "within"))
ordered <- unique(guide_within[order(guide_within)])
# If any targets contained within a chimeric read, remove all members of set
if (length(ordered) > 0){
lns_rle <- rle(names(chimeras)[ordered])$lengths
grps <- rep(1:length(lns_rle), lns_rle)
is_first <- paste(grps, bitwAnd(mcols(chimeras)$flag[ordered], 64),
sep = ".")
not_dup <- !(duplicated(is_first) | duplicated(is_first, fromLast = TRUE))
# Remove all chimeras with guides included from the chimeric sets
non_ch <- names(chimeras) %in% names(chimeras)[ordered][not_dup]
ch_idxs <- ch_idxs[!non_ch]
chimeras <- bam[ch_idxs]
}
# Assign chimeras to targets
tgt_plus_tol <- targets + tolerance
hits <- findOverlaps(chimeras, tgt_plus_tol, ignore.strand = TRUE)
# Exclude members that match multiple targets
is_dup <- duplicated(queryHits(hits)) | duplicated(queryHits(hits), fromLast = TRUE)
hits <- hits[!is_dup]
splits <- split(queryHits(hits), subjectHits(hits))
#For each hit, collect all alignments with the same name
idx_by_primer <- lapply(splits, function(idxs){
ch_idxs[names(chimeras) %in% names(chimeras)[idxs]]
})
ibp <- unlist(idx_by_primer)
alnsByPCR <- lapply(idx_by_primer, function(ids){ bam[ids]})
chimerasByPCR[names(splits)] <- alnsByPCR
if (isTRUE(verbose)){
# How many chimeric sets were not assigned?
n_inc <- length(unique(ibp))
n_total <- length(ch_idxs)
n_dup <- sum(duplicated(ibp) | duplicated(ibp, fromLast = TRUE))
pct_inc <- n_inc/n_total * 100
pct_multi <- n_dup/n_total * 100
removed <- original_ln - length(chimeras)
rm_pct <- removed/original_ln * 100
message(sprintf(paste0("%s from %s (%.2f%%) chimeras did not involve guide\n",
"%s from %s (%.2f%%) remaining chimeric reads included\n",
"%s (%.2f%%) assigned to more than one target\n"),
removed, original_ln, rm_pct, n_inc, n_total,
pct_inc, n_dup, pct_multi))
}
# Remove chimeras from the bam
if (length(ch_idxs) >= 2){
bam <- bam[-ch_idxs]
}
# Return list of chimerasByPCR and bam
result <- list(bam = bam, chimerasByPCR = chimerasByPCR)
result
} # -----
# alnsToCrisprSet -----
#@param label.alleles (logical(1)) Calculate allele labels using the
#default counting method. If FALSE, allele labels are not set at
#initialisation (Default: TRUE).
alnsToCrisprSet <- function(alns, reference, target, reverse.complement,
collapse.pairs, names, use.consensus, target.loc,
verbose, orientation, chimeras = NULL,
store.chimeras = FALSE, minoverlap = NULL,
allele.labels = TRUE, ...){
# Flag for whether variants should be counted w.r.t the negative strand
rc <- rcAlns(as.character(strand(target)), orientation)
# The reference is with respect to the guide. If the opposite
# strand is being displayed, reverse the reference.
# For display wrt target, rc is TRUE for -ve, FALSE for +v
is_neg <- as.character(strand(target)) == "-"
#if (! (is_neg == rc)){
# reference <- Biostrings::reverseComplement(reference)
#}
# Narrow alignments for each sample
crispr.runs <- lapply(seq_along(alns), function(i){
aln <- alns[[i]]
if (!class(aln) == "GAlignments") {
aln <- GenomicAlignments::GAlignments()
}
chim <- chimeras[[i]]
if (is.null(chim)) {chim <- GenomicAlignments::GAlignments()}
checked <- "checked" %in% names(list(...))
crun <- readsToTarget(aln, target = target,
reverse.complement = reverse.complement, chimeras = chim,
collapse.pairs = collapse.pairs, use.consensus = use.consensus,
verbose = verbose, name = names[i], orientation = orientation,
minoverlap = minoverlap, target.loc = target.loc,
checked = checked)
crun
})
# Remove empty samples
to_rm <- sapply(crispr.runs, is.null)
if (any(to_rm)){
if (verbose){
rm_nms <- paste0(names[to_rm], collapse = ",", sep = "\n")
message(sprintf("Excluding samples that have no on target reads:\n%s",
rm_nms))
}
crispr.runs <- crispr.runs[!to_rm]
names <- names[!to_rm]
if (length(crispr.runs) == 0) {
warning("Could not narrow reads to target, ",
"no samples have on-target alignments")
return()
}
}
# Combine samples into a single object
cset <- CrisprSet(crispr.runs, reference, target, rc = rc,
target.loc = target.loc,
verbose = verbose, names = names, ...)
# Set the allele labels
if (isTRUE(allele.labels) & ! all(lengths(alns(cset)) == 0)){
cig_labs_defaults = list(renumbered = TRUE,
match_label = "no variant",
mismatch_label = "SNV",
split.snv = TRUE,
upstream.snv = 8,
downstream.snv = 6,
bpparam = BiocParallel::SerialParam())
dots <- list(...)
cig_labs_defaults <- modifyList(cig_labs_defaults,
dots[names(dots) %in% names(cig_labs_defaults)])
do.call(cset$setCigarLabels, cig_labs_defaults)
}
cset
} # -----
# readTargetBam -----
#'@title Internal CrispRVariants function for reading and filtering a bam file
#'@description Includes options for excluding reads either by name or range.
#'The latter is useful if chimeras are excluded. Reads are excluded before
#'chimeras are detected, thus a chimeric read consisting of two sections, one of
#'which overlaps an excluded region, will not be considered chimeric.
#'Chimeric reads can be ignored, excluded, which means that all sections of a
#'chimeric read will be removed, or merged, which means that chimeras will be
#'collapsed into a single read where possible. (Not implemented yet)
#'If chimeras = "merge", chimeric reads are merged if all segments
# are from the same chromosome, do not overlap, and are aligned to the same strand.
# It is assumed that sequences with two alignments are chimeras, not alternate mappings
#'@param file The name of a bam file to read in
#'@param target A GRanges object containing a single target range
#'@param exclude.ranges A GRanges object of regions that should not be counted,
#'e.g. primer or cloning vector sequences that have a match in the genome
#'@param exclude.names A vector of read names to exclude.
#'@param chimera.to.target Maximum distance between endpoints of chimeras and
#'target.loc for assigning chimeras to targets (default: 5)
#'@param chimeras Flag to determine how chimeric reads are treated. One of
#'"ignore", "exclude", "count" and "merge". Default "ignore".
#'@param max.read.overlap Maximum number of bases mapped to two positions
#'for chimeras to be merged (Default: 10)
#'@param max.unmapped Maximum number of bases that are unmapped for chimeras
#'to be merged (Default: 4)
#'@param verbose Print stats about number of alignments read and filtered. (Default: TRUE)
#'@param by.flag Is the supplementary alignment flag set? Used for identifying chimeric
#'alignments, function is much faster if TRUE. Not all aligners set this flag. If FALSE,
#'chimeric alignments are identified using read names (Default: TRUE)
#'@return A GenomicAlignments::GAlignment obj
readTargetBam <- function(file, target, exclude.ranges = GRanges(),
exclude.names = NA, chimera.to.target = 5,
chimeras = c("count", "ignore","exclude","merge"),
max.read.overlap = 10, max.unmapped = 4,
by.flag = TRUE, verbose = TRUE){
ch.action <- match.arg(chimeras)
if (ch.action == "ignore"){
# If chimeras are not to be excluded or merged,
# we only need to read in reads overlapping the target region
if (! file.exists(paste0(file, ".bam"))){
Rsamtools::indexBam(file)
}
param <- Rsamtools::ScanBamParam(what = c("seq", "flag"), which = target)
} else {
# In this case, must read in the entire bam to be sure of finding chimeric reads
param <- Rsamtools::ScanBamParam(what = c("seq", "flag"))
}
bam <- GenomicAlignments::readGAlignments(file, param = param, use.names = TRUE)
if (length(bam) == 0){
return(list(bam = GenomicAlignments::GAlignments(),
chimeras = GenomicAlignments::GAlignments()))
}
# Check that "seq" is not empty
unq_wdths <- unique(width(mcols(bam)$seq))
if (length(unq_wdths) == 0){
if (unq_wdths == 0) stop("No sequence found in bam file")
}
#Exclude reads by name or range
temp <- excludeFromBam(bam, exclude.ranges, exclude.names)
if (isTRUE(verbose)){
original <- length(bam)
message(sprintf("Read %s alignments, excluded %s\n", original,
original - length(temp)))
}
bam <- temp
if (length(bam) == 0 | ch.action == "ignore"){
return(list(bam = bam, chimeras = GenomicAlignments::GAlignments()))
}
chimera_idxs <- findChimeras(bam, by.flag = by.flag)
if (chimeras == "exclude"){
if( length(chimera_idxs) >= 2){
bam <- bam[-chimera_idxs]
}
if (isTRUE(verbose)){
message(sprintf("%s reads after filtering chimeras\n", length(bam)))
}
return(list(bam = bam, chimeras = GenomicAlignments::GAlignments()))
}
if (chimeras == "count"){
temp <- separateChimeras(bam, target, tolerance = chimera.to.target,
by.flag = by.flag, verbose = verbose)
return(list(bam = temp$bam, chimeras = temp$chimeras[[1]]))
}
if (chimeras == "merge"){
result <- mergeChimeras(bam, chimera_idxs,
max_read_overlap = max.read.overlap,
max_unmapped = max.unmapped,
verbose = verbose)
return(list(bam = c(bam[-chimera_idxs], result$merged),
chimeras = result$unmerged))
}
} # -----
# rcAlns -----
#'@title Internal CrispRVariants function for determining read orientation
#'@description Function for determining whether reads should be oriented to the
#'target strand, always displayed on the positive strand, or oriented to
# the strand opposite the target.
#'@param target.strand The target strand (one of "+","-","*")
#'@param orientation One of "target", "opposite" and "positive" (Default: "target")
#'@return A logical value indicating whether reads should be reverse complemented
#'@author Helen Lindsay
rcAlns <- function(target.strand, orientation){
if (orientation %in% c("opposite","target") & target.strand == "*"){
warning(paste0("Target does not have a strand\n",
"Orienting reads to reference strand."))
return(FALSE)
}
if (orientation == "positive") return(FALSE)
if (orientation == "target"){
if (target.strand == "-") return(TRUE)
}
if (orientation == "opposite"){
if (target.strand == "+") return(TRUE)
}
return(FALSE)
} # -----
# collapsePairs -----
#'@title Internal CrispRVariants function for collapsing pairs with concordant indels
#'@description Given a set of alignments to a target region, finds read pairs.
#'Compares insertion/deletion locations within pairs using the cigar string.
#'Pairs with non-identical indels are excluded. Pairs with identical indels are
#'collapsed to a single read, taking the consensus sequence of the pairs.
#'@param alns A GAlignments object. We do not use GAlignmentPairs because amplicon-seq
#'can result in pairs in non-standard pairing orientation.
#'Must include BAM flag, must not include unmapped reads.
#'@param use.consensus Should the consensus sequence be used if pairs have a mismatch?
#'Setting this to be TRUE makes this function much slower (Default: TRUE)
#'@param keep.unpaired Should unpaired and chimeric reads be included? (Default: TRUE)
#'@param verbose Report statistics on reads kept and excluded
#'@param ... Additional items with the same length as alns,
#'that should be filtered to match alns.
#'@return The alignments, with non-concordant pairs removed and concordant pairs
#'represented by a single read.
#'@author Helen Lindsay
collapsePairs <- function(alns, use.consensus = TRUE, keep.unpaired = TRUE,
verbose = TRUE, ...){
dots <- list(...)
if (length(dots) > 0){
if (! unique(sapply(dots, length)) == length(alns)){
stop("Each ... argument supplied must have the ",
"same length as the alignments")
}
}
# 1 = 2^0 = paired flag
# 2048 = 2^11 = supplementary alignment flag
is_primary <- !(bitwAnd(mcols(alns)$flag, 2048) & bitwAnd(mcols(alns)$flag, 1))
pairs <- findChimeras(alns[is_primary], by.flag = FALSE)
# Above just matches read names
# If there are no pairs, no need to do anything further
if (length(pairs) == 0){
if (isTRUE(keep.unpaired)){
return(c(list("alignments" = alns), dots))
} else {
return(NULL)
}
}
# Pairs are primary alignments with the same name
nms <- rle(names(alns)[is_primary][pairs])
nms_codes <- rep(1:length(nms$lengths), nms$lengths)
# If reads have the same insertions and deletions, they have identical cigar strings
cig_runs <- rle(paste(cigar(alns)[is_primary][pairs], nms_codes, sep = "."))$lengths
concordant <- rep(cig_runs, cig_runs) == rep(nms$lengths,nms$lengths)
# Keep first alignment from all concordant pairs
# Flag 64 = 2^6 = first alignment in pair
is_pair <- which(is_primary)[pairs]
is_first <- as.logical(bitwAnd(mcols(alns)$flag[is_pair], 64))
keep <- is_pair[concordant & is_first]
if (verbose){
nunpaired <- length(alns) - length(is_pair)
cc_true <- sum(concordant)/2
cc_false <- sum(!concordant)/2
stats <- paste0("\nCollapsing paired alignments:\n",
"%s original alignments\n",
" %s are not part of a primary alignment pair\n",
" (singletons and chimeras)\n",
" %s reads are paired \n",
" %s pairs have the same insertions/deletions\n",
" %s pairs have different insertions/deletions\n",
"Keeping the first member of %s concordant read pairs\n")
message(sprintf(stats, length(alns), nunpaired, length(is_pair),
cc_true, cc_false, cc_true))
}
if (keep.unpaired){
# Keep non-pairs, including non-primary and singletons
keep <- c(keep, setdiff(c(1:length(alns)),is_pair))
if (verbose) message(sprintf("Keeping %s unpaired reads\n", nunpaired))
}
keep_alns <- alns[keep]
if (use.consensus){
seq_runs <- rle(paste0(nms_codes, mcols(alns[is_primary][pairs])$seq))$lengths
same_seq <- rep(seq_runs, seq_runs) == rep(nms$lengths, nms$lengths)
ncc_seqs <- mcols(alns[is_primary][pairs][concordant & !same_seq])$seq
if (verbose){
message(sprintf("Finding consensus for %s pairs with mismatches\n",
length(ncc_seqs)/2))
}
if (length(ncc_seqs) >= 2){
consensus <- sapply(seq(1,length(ncc_seqs), by = 2), function(i){
Biostrings::consensusString(ncc_seqs[i:(i+1)])
})
# Overwrite the sequence of the non-concordant pairs.
# The concordant alignments are at the start of keep
ncc_idxs <- cumsum(concordant & is_first)[concordant & is_first & !same_seq]
mcols(keep_alns[ncc_idxs])$seq <- Biostrings::DNAStringSet(consensus)
}
}
if (length(keep) == 0) return(NULL)
filtered.dots <- lapply(dots, function(x) x[keep])
result <- c(list("alignments" = keep_alns), filtered.dots)
result
} # -----
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.