degradeSAs: Remove or degrade intrinisc strength of splice acceptors...

In caggtaagtat/ModCon: Modifying splice site usage by changing the mRNP code, while maintaining the genetic code

Description

Degrade or remove splice acceptor sites of certain intrinsic strength (in MaxEntScan score) from a coding sequence by codon selection while keeping the HZEI integral up.

Usage

degradeSAs(fanFunc, maxhbs=10, maxME=4, increaseHZEI=TRUE)

Arguments

fanFunc	codon matrix with two rows (see example below)
maxhbs	Numeric treshold which strength of internal donor sites should be degraded (in HBS)
maxME	Numeric treshold which strength of internal acceptor sites should be degraded (in MaxEntScan score)
increaseHZEI	Logical value if HZEI integral should be increased or decreased during SD degradation. If TRUE, function aims to increase HZEI integral.

Value

Character value of a nucleotide sequence encoding the same amino acid as the entered codon matrix fan, but the intrinsic strength of all present splice acceptor (SA) sites is degraded as much as possible, in case they exceed the given treshold maxME. Additionally, splice donor site strengths greater maxhbs are avoided, during SA degradation.

Examples

library(data.table)
sdMaximalHBS <- 10
acMaximalMaxent <- 4
increaseHZEI <- TRUE
## Initiaing the Codons matrix plus corresponding amino acids
ntSequence <- 'TTTTGTCTTTTTCTGTGTGGCAGTGGGATTAGCCTCCTATCGATCTATGCGATA'
## Create Codon Matrix by splitting up the sequence by 3nt
fanFunc <- createCodonMatrix(ntSequence)
degradeSAs(fanFunc, maxhbs=sdMaximalHBS, maxME=acMaximalMaxent, increaseHZEI=increaseHZEI)

caggtaagtat/ModCon documentation built on March 12, 2021, 4:12 a.m.