ModCon: ModCon

In caggtaagtat/ModCon: Modifying splice site usage by changing the mRNP code, while maintaining the genetic code

Description

Execute ModCon on a donor site within a coding sequnece either increasing or decreasing its HZEI weight.

Usage

ModCon(cds, sdSeqStartPosition, upChangeCodonsIn=16, downChangeCodonsIn=16,
optimizeContext=TRUE, sdMaximalHBS=10, acMaximalMaxent=4, optiRate=100,
nGenerations=50, parentSize=300, startParentSize=1000, bestRate=40,
semiLuckyRate=20, luckyRate=5, mutationRate=1e-04, nCores=-1)

Arguments

cds	Character value of coding nucleotide sequence which holds the splice site of interest
sdSeqStartPosition	Numeric value of the position of the first nucleotide of the splice donor of interest
upChangeCodonsIn	Numeric value of number of codons to change upstream of the donor site of interest
downChangeCodonsIn	Numeric value of number of codons to change downstream of the donor site of interest
optimizeContext	Character value which determines, if TRUE (the default) the donor context will be adjusted to increase the splice site HEXplorer weight (SSHW), if FALSE, the SSHW will be decreased.
sdMaximalHBS	Numeric value of minimal HBS of SDs which should be tried to be degraded in their intrinsic strength
acMaximalMaxent	Numeric value of minimal MaxEntScan score of SAs which should be tried to be degraded in their intrinsic strength
optiRate	Numeric value setting level of HZEI integral optimization
nGenerations	Numeric value setting maximal number of generations
parentSize	Numeric value setting size of parent generations, generated from previous generations
startParentSize	Numeric value setting size of initiated parent generation of sequences
bestRate	Numeric value setting percentage how many of the fittest sequences are used to produce the next generation
semiLuckyRate	Numeric value setting percentage of sequences which are selected for breeding with a probability based on the respective HZEI-score integral
luckyRate	Numeric value setting percentage of sequences which are randomly selected for breeding
mutationRate	Numeric value setting chance of each codon, to mutate randomly within a child sequence
nCores	Numeric value setting number of cores which should be used for parallel computations. If set to '-1' all availible cores are selected.

Value

Creates a character value of a coding nucleotide sequence encoding the same amino acid sequence as the entered cds, but with an alternative nucleotide surrounding around the splice donor (SD) sequence position, stated with sdSeqStartPosition. Depending on the entered optimizeContext, the SD surrounding is either adjusted aiming to enhance or decrease the splice site HEXplorer wheigth.

Examples

## Load R packages
library('parallel')
library('utils')
library('data.table')

## Set parameters for simplest use of ModCon (optimizing to 100%)
cds <- paste0('ATGGAAGACGCCAAAAACATAAAGAAAGGCCCGGCGCCATTCTATCCGCTGGAAGATGGAACCGCTGGAGAGCAACTGCA',

'TAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAA',
'TGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTAT',
'GCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCG',
'CAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGG',
'ATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGA',
'GTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCC',
'TGCGTGAGATTCTCGCATGCCAGAGATCCTATTTTTGGCAATCAAATCATTCCGGATACTGCGATTTTAAGTGTTGTTCCATTCCATCACGGTT',
'TTGGAATGTTTACTACACTCGGATATTTGATATGTGGATTTCGAGTCGTCTTAATGTATAGATTTGAAGAAGAGCTGTTTCTGAGGAGCCTTCA',
'GGATTACAAGATTCAAAGTGCGCTGCTGGTGCCAACCCTATTCTCCTTCTTCGCCAAAAGCACTCTGATTGACAAATACGATTTATCTAATTTA',
'CACGAAATTGCTTCTGGTGGCGCTCCCCTCTCTAAGGAAGTCGGGGAAGCGGTTGCCAAGAGGTTCCATCTGCCAGGTATCAGGCAAGGATATG',
'GGCTCACTGAGACTACATCAGCTATTCTGATTACACCCGAGGGGGATGATAAACCGGGCGCGGTCGGTAAAGTTGTTCCATTTTTTGAAGCGAA',
'GGTTGTGGATCTGGATACCGGGAAAACGCTGGGCGTTAATCAAAGAGGCGAACTGTGTGTGAGAGGTCCTATGATTATGTCCGGTTATGTAAAC',
'AATCCGGAAGCGACCAACGCCTTGATTGACAAGGATGGATGGCTACATTCTGGAGACATAGCTTACTGGGACGAAGACGAACACTTCTTCATCG',
'TTGACCGCCTGAAGTCTCTGATTAAGTACAAAGGCTATCAGGTGGCTCCCGCTGAATTGGAATCCATCTTGCTCCAACACCCCAACATCTTCGA',
'CGCAGGTGTCGCAGGTCTTCCCGACGATGACGCCGGTGAACTTCCCGCCGCCGTTGTTGTTTTGGAGCACGGAAAGACGATGACGGAAAAAGAG',
'ATCGTGGATTACGTCGCCAGTCAAGTAACAACCGCGAAAAAGTTGCGCGGAGGAGTTGTGTTTGTGGACGAAGTACCGAAAGGTCTTACCGGAA',
'AACTCGACGCAAGAAAAATCAGAGAGATCCTCATAAAGGCCAAGAAGGGCGGAAAGATCGCCGTG')

## Execute ModCon
finalSequence <- ModCon(cds, 1001)

## Print final cds sequence with the alternative SD nucleotide surrounding
print(finalSequence)




## More parameters can be set for use of ModCon when not optimizing to 100% (e.g. 50%)

## Execute ModCon
finalSequence <- ModCon(cds, 1001, upChangeCodonsIn=16, downChangeCodonsIn=16,
optimizeContext=FALSE, sdMaximalHBS=10, acMaximalMaxent=4,
optiRate=50, nGenerations=5, parentSize=200, startParentSize=800,
bestRate=50, semiLuckyRate=10, luckyRate=5, mutationRate=1e-03, nCores=1)

## Print final cds sequence with the alternative SD nucleotide surrounding
print(finalSequence)

caggtaagtat/ModCon documentation built on March 12, 2021, 4:12 a.m.