Nothing
#' Create TAPseq input from target sequences
#'
#' This function creates input for TAP-seq primer design from a DNAStringSet containing the
#' target sequences (typically transcript sequences).
#'
#' @param target_sequences A named \code{\link[Biostrings:XStringSet-class]{DNAStringSet}} object
#' containing all target sequences.
#' @param product_size_range Numerical vector of length 2 specifying the desired length of the
#' resulting amplicons.
#' @param beads_oligo Beads-oligo-dT sequence for the used droplet sequencing protocol (10x,
#' Drop-seq). If nothing is specified (\code{beads_oligo = NA}), the 10x V3 Beads-oligo-dT
#' sequence is used. Can be changed if primers are for instance designed for Drop-seq. Any barcode
#' bases need to be replaced by \code{N}.
#' @param reverse_primer Reverse primer sequence used for all PCR reactions. Default is the 10x
#' primer sequence: \code{CTACACGACGCTCTTCCGATCT}.
#' @param target_annot (optional) A named \code{\link[GenomicRanges:GRangesList-class]{GRangesList}}
#' object with transcript annotations in case the targets are transcripts of gene loci.
#' If provided, each \code{\link[GenomicRanges:GRanges-class]{GRanges}} within the list
#' should contain all exons of one targeted transcripts. Names need to be the same as for
#' \code{target_sequences}.
#' @param primer_num_return How many forward primers should be designed? (default: 5)
#' @param min_primer_region Minimum sequence length required for primer design. Mostly relevant in
#' case a sequence template is too short to allow the specified \code{product_size_range}.
#' @param primer_opt_tm,primer_min_tm,primer_max_tm Optimal, minumum and maximum primer melting
#' temperature. Set to NA to use Primer3s default values.
#' @return \code{\link[TAPseq:TsIOList-class]{TsIOList}} object.
#' @examples
#' # chromosome 11 truncated transcript sequences and annotations
#' data("chr11_truncated_txs_seq")
#'
#' # create TsIOList object for primer design from target sequences
#' obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500))
#' obj
#'
#' # transcript annotations can be added for optional genome browser tracks of designed primers
#' data("chr11_truncated_txs")
#' obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500),
#' target_annot = chr11_truncated_txs)
#'
#' # create input for primer design with Drop-seq instead of default 10x
#' ds_oligo <- "TTTTTTTAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"
#' ds_rev_primer <- "AAGCAGTGGTATCAACGCAGAGT"
#' ds_obj <- TAPseqInput(chr11_truncated_txs_seq, beads_oligo = ds_oligo,
#' reverse_primer = ds_rev_primer, product_size_range = c(350, 500),
#' primer_opt_tm = 62, primer_min_tm = 57, primer_max_tm = 65)
#' @export
TAPseqInput <- function(target_sequences, product_size_range,
beads_oligo = NA, reverse_primer = "CTACACGACGCTCTTCCGATCT",
target_annot = NULL, primer_num_return = 5, min_primer_region = 100,
primer_opt_tm = 63, primer_min_tm = 59, primer_max_tm = 66) {
# make sure that sequence template has the right format
if (!is(target_sequences, "DNAStringSet") | is.null(names(target_sequences))) {
stop("sequence_templates must be a named DNAStringSet object", call. = FALSE)
}
# make sure that target_annot has the right format (if provided)
if (!is.null(target_annot)) {
# check that it is a names GRangesList
if (!is(target_annot, "GRangesList") | length(target_annot) != length(target_sequences)) {
stop("target_annot must be a named GRangesList object of the same length as target_sequences",
call. = FALSE)
}
# check names are the same as target_sequences
targets <- sort(names(target_sequences))
if (!identical(sort(names(target_annot)), targets)) {
stop("Names of target_annot and target_sequences are not the same", call. = FALSE)
}
# sort target_sequences and target_annots by name
target_sequences <- target_sequences[targets]
target_annot <- target_annot[targets]
} else {
# create empty list in case target_annot was not provided
target_annot <- vector(mode = "list", length = length(target_sequences))
}
# parse beads_oligo argument
if (is.na(beads_oligo)) beads_oligo <- get_beads_oligo()
# create TsIO objects for every sequence template
io <- mapply(FUN = TsIO,
target_sequence = target_sequences,
target_annot = target_annot,
sequence_id = names(target_sequences),
MoreArgs = list(
beads_oligo = beads_oligo, reverse_primer = reverse_primer,
product_size_range = product_size_range, primer_num_return = primer_num_return,
min_primer_region = min_primer_region, primer_opt_tm = primer_opt_tm,
primer_min_tm = primer_min_tm, primer_max_tm = primer_max_tm),
SIMPLIFY = FALSE)
# convert to TsIOList object
TsIOList(io)
}
#' Create boulder IO record
#'
#' Takes a \code{\link[TAPseq:TsIO-class]{TsIO}} or \code{\link[TAPseq:TsIOList-class]{TsIOList}}
#' object and converts it into a boulder IO record for Primer3. Essentially it converts it into a
#' list of character vectors that each contain the tag and the value in the form: "TAG=VALUE". More
#' on this format can be found in the \href{http://primer3.org/manual.html}{Primer3 manual}.
#'
#' This function is usually not needed by the user, because functions such as
#' \code{\link[TAPseq]{designPrimers}} handle IO record generation. However, this function can for
#' instance be useful to generate IO records, write them to a file and pass them to Primer3 in the
#' conventional way.
#'
#' @param object TsIO of TsIOList object for which a Primer3 boulder IO record should be created.
#' @param thermo_params_path Optional path (character) to the \code{primer3_config} directory. Only
#' required when using Primer3 < 2.5.0.
#' @return A character vector containing the lines of the IO record.
#' @seealso \url{http://primer3.org/manual.html} for Primer3 manual.
#' @examples
#' # chromosome 11 truncated transcript sequences
#' data("chr11_truncated_txs_seq")
#'
#' # create TsIOList object for primer desing from sequence templates
#' obj <- TAPseqInput(chr11_truncated_txs_seq, product_size_range = c(350, 500))
#'
#' # create boulder IO record
#' boulder_io <- createIORecord(obj)
#' head(boulder_io, 11)
#' @export
setGeneric("createIORecord",
function(object, thermo_params_path = NA) standardGeneric("createIORecord")
)
#' @describeIn createIORecord Create IO record from \code{TsIO} objects.
#' @export
setMethod("createIORecord", "TsIO", function(object, thermo_params_path) {
# slot names of values for Primer3 that do not need to be processed
slot_names <- c("sequence_id", "reverse_primer", "primer_num_return", "primer_opt_tm",
"primer_min_tm", "primer_max_tm")
# get values of all slots as one character vector
io <- vapply(slot_names, FUN = function(s, x) {
as.character(slot(x, s))
}, x = object, FUN.VALUE = character(1))
# add sequence_template
io <- c(io[1], "sequence_template" = as.character(sequence_template(object)), io[-1])
# rename reverse_primer to Primer3 argument name
rev_index <- which(names(io) == "reverse_primer")
names(io)[rev_index] <- "sequence_primer_revcomp"
# add Primer3 parameters required to trigger design of only forward primers
io["primer_pick_left_primer"] <- "1"
io["primer_pick_right_primer"] <- "0"
# calculate and add excluded regions
excluded_regions <- create_excluded_regions(object)
io["sequence_excluded_region"] <- excluded_regions
# add thermodynamic parameters path to io
io <- c(io, "primer_thermodynamic_parameters_path" = thermo_params_path)
# remove any NA elements, because they should not be part of the primer3 input
io <- io[!is.na(io)]
# transform to vector where each element contains one input line ("tag=value" format)
io <- paste0(toupper(names(io)), "=", io)
# add "=" record separator at the end of the output vector
c(io, "=")
})
#' @describeIn createIORecord Create IO record from \code{TsIO} objects.
#' @export
setMethod("createIORecord", "TsIOList", function(object, thermo_params_path) {
# create IO records for every TsIO object
io <- lapply(object, FUN = createIORecord, thermo_params_path = thermo_params_path)
names(io) <- NULL
# convert into vector
unlist(io)
})
## HELPER FUNCTIONS ================================================================================
# get beads oligo sequence for standard droplet sequencing protocol. currently this function is only
# used internally and not exported via NAMESPACE
get_beads_oligo <- function(protocol = c("10x_v3", "10x_v2", "dropseq")) {
protocol <- match.arg(protocol)
switch(protocol,
"10x_v3" = "CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT",
"10x_v2" = "CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT",
"dropseq" = "TTTTTTTAAGCAGTGGTATCAACGCAGAGTACNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"
)
}
# create excluded regions that respect the specified product size range specified in a TsIO object
create_excluded_regions <- function(object) {
# ------------------------------------------------------------------------------------------------
# STEP 1:
# match reverse primer to sequence and get start and stop positions of right primer binding site
# ------------------------------------------------------------------------------------------------
# sequence id and sequence template
seq_id <- sequence_id(object)
seq <- sequence_template(object)
# create reverse complement of right primer
rc_rev_primer <- Biostrings::reverseComplement(reverse_primer(object))
# match right primer to seq
match <- Biostrings::matchPattern(pattern = rc_rev_primer, subject = seq)
match <- ranges(match)
# get maximum product length if primer matches once, else abort with informative error message
if (length(match) == 1) {
max_product_size <- BiocGenerics::end(match)
reverse_primer_start <- BiocGenerics::start(match)
reverse_primer_length <- BiocGenerics::width(match)
} else if (length(match) > 1) {
stop("reverse primer matches the sequence multiple times for: ", seq_id, call. = FALSE)
} else {
stop("reverse primer doesn't match sequence template for: ", seq_id, call. = FALSE)
}
# ------------------------------------------------------------------------------------------------
# STEP 2:
# calculate excluded regions, that would generate products outside of the desired product size
# range if primers would be designed there and specify them as excluded regions for Primer3
# ------------------------------------------------------------------------------------------------
# get the specified product size range and minimum primer region
prod_size_range <- product_size_range(object)
min_primer_region <- min_primer_region(object)
# 2 excluded regions are designed, which span the sequence up- and downstream of the region that
# yields primers with the desired product_size_range
r1_start <- 0
r1_length <- max_product_size - prod_size_range[2]
r2_start <- max_product_size - prod_size_range[1] + 1
r2_length <- length(seq) - r2_start
# if the length of the first region is positive, both regions are valid and are created
if (r1_length > 0) {
# paste together in primer3 format
sprintf("%s,%s %s,%s", r1_start, r1_length, r2_start, r2_length)
# create r2 as only excluded region if the region resulting from r2 is >= the min_primer_region
} else if (r2_start >= min_primer_region){
sprintf("%s,%s", r2_start, r2_length)
# else adapt r2 so that min_primer_size is respected (if possible)
} else if (min_primer_region < reverse_primer_start) {
warning("Desired product size range not possible! Product size will be shorter for: ",
seq_id, call. = FALSE)
r2_start <- min_primer_region
r2_length <- length(seq) - r2_start
sprintf("%s,%s", r2_start, r2_length)
} else {
stop("Can't respect min_primer_region, sequence too short for: ", seq_id, call. = FALSE)
}
}
Any scripts or data that you put into this service are public.
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.