#' The Reverse chars
#'
#' The Reverse chars
#'
#' This function calculates Reverse chars
#'
#' @param x the input data, which should be a string.
#'
#' @return A vector
#'
#' @keywords extract reverse_chars
#'
#' @aliases revchars
#'
#' @author Min-feng Zhu <\email{wind2zhu@@163.com}>
#'
#' @export revchars
#'
#' @note if the user defined physicochemical indices have not been normalized, it should be normalized.
#'
#' @examples
#'
#' x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
#' revchars(x)
#'
revchars = function (x) {
reversed_split = rev(strsplit(as.character(x), split = "")[[1]])
reverse_chars = paste(unlist(reversed_split), collapse = "")
return(reverse_chars)
}
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.