Description Usage Arguments Details Value Note Author(s) Examples
The Reverse chars
1 | revchars(x)
|
x |
the input data, which should be a string. |
This function calculates Reverse chars
A vector
if the user defined physicochemical indices have not been normalized, it should be normalized.
Min-feng Zhu <wind2zhu@163.com>
1 2 3 |
x = 'GACTGAACTGCACTTTGGTTTCATATTATTTGCTC'
revchars(x)
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.