R/allClasses.R

Defines functions .simpfy getTaxonTable getSequenceTableNoChime getSequenceTable getMergers getDadaR getDadaF getDerepR getDerepF getStratifiedFilesR getStratifiedFilesF .getSlot MultiAmplicon PrimerPairsSet PairedReadFileSet

Documented in getDadaF getDadaR getDerepF getDerepR getMergers getSequenceTable getSequenceTableNoChime getStratifiedFilesF getStratifiedFilesR getTaxonTable MultiAmplicon PairedReadFileSet PrimerPairsSet

##' A class representing file paths to paired end reads.
##'
##' Two character vectors of the same length specifying file names of
##' paired end reads can be stored in this class. Filenames a checked
##' for their existence. Usually these are the filnames of quality
##' filtered fastq files already stratified into samples (one file
##' pair for each sample). 
##'
##' @slot readF A character vector specifying the file paths to files
##'     containing forward (sometimes called R1) sequencing
##'     reads. This vector can be named to store short short-name of
##'     samples.
##'
##' @slot readR A character vector specifiying the file path to a file
##'     containing reverse (sometimes called R2) sequencing
##'     reads. This vector can be named to store short short-name of
##'     samples. Names of readF and readR should be identical in this
##'     case
##'
##' @slot names Is either (first choice) from names of the forward
##'     reads, or (if these are empty) constructed from basename of
##'     forward read files (filename without directory).
##' 
##' @return PairedReadFileSet
##' @author Emanuel Heitlinger
setClass("PairedReadFileSet",
         slots = c(readsF="character", readsR="character", names="character"),
         contains = c(readsF="character", readsR="character", names="character"),
         validity=function(object) {
             all.files <- c(object@readsF, object@readsR)
             ## missing.file <- !file.exists(all.files)
             ## if (any(missing.file)){
             ##     warning(paste0("\nfile ", all.files[missing.file], " does not exist on your system"))
             ## }
             if (length(object@readsF) != length(object@readsR)){
                 "Same number of forward and reverse reads files needed to constitute files of paired end reads"}
             else{TRUE}
         })

    

##' @param readsF The path and filenames containing forward (R1) reads
##' @param readsR The path and filenames containing reverse (R2) reads
##' @export PairedReadFileSet
##' @describeIn PairedReadFileSet-class Constructor for
##'     PairedReadFileSet-class
PairedReadFileSet <- function(readsF=character(), readsR=character()){
    ## construct from names if they exist
    if(length(names(readsF)) == length(readsF)) {
        na <- as.character(names(readsF)) ## as.c to catch empty (NULL)
    } else {na <- basename(readsF)} ## otherwise use filenames
    ## set all names the same!
    names(readsF) <- na
    names(readsR) <- na
    new("PairedReadFileSet",
        readsF = readsF,
        readsR = readsR,
        names = na)
}

## ## probably could implement this more cleverly using inheritance
##' @rdname PairedReadFileSet-class
##' @export
setMethod("length", "PairedReadFileSet", function(x) length(x@readsF))


##' A class representing sequences of forward and reverse primers.
##'
##' The PrimerPairsSet class is a container for storing primer pairs.
##' This means exactly two \code{\link[Biostrings]{DNAStringSet}}
##' objects of the same length specifying primer-pairs. Primer
##' sequences can be provided as character strings and will be
##' converted to \code{\link[Biostrings]{DNAStringSet}} by the
##' constructor function of the same name. primerF and primerR have to
##' be of the same length to specify primer pairs. Warnings are
##' given if primer sequences are of unusual length (<16 or >26 bases).
##'
##' @slot primerF DNAStringSet. Can be named or unnamed.
##' @slot primerR DNAStringSet of the same length. Can be named or
##'     unnamed.
##' @slot names Character string. Either constructed as a
##'     concatenation of names of forward and reverse primers or of
##'     their sequences (if primer sequences are unnamed).
##' @slot .mapF (automatically generated) maps potentially duplicate
##'     entries in FW primers to unique entries.
##' @slot .mapR (auto-generated) maps potentially duplicate entries in
##'     FW primers to unique entries.
##' @slot .uniqueF (auto-generated) unique forward primers as
##'     character strings.
##' @slot .uniqueR (auto-generated) unique reverse primers as
##'     character strings.
##' 
##' @seealso \code{\link[Biostrings]{DNAStringSet}}
##' @importFrom Biostrings DNAStringSet
##' @return PrimerPairsSet-class
##' @author Emanuel Heitlinger
setClass("PrimerPairsSet", contains = "DNAStringSet",
         representation(primerF="DNAStringSet", primerR="DNAStringSet",
                        names="character", 
                        .mapF="numeric", .mapR="numeric",
                        .uniqueF="character", .uniqueR="character"),         
         validity=function(object) {
             if (any(width(c(object@primerF, object@primerR))<10)){
                 warning("short primer (<10nt) provided are you sure about your primer sequences?")
             }
             if (any(width(c(object@primerF, object@primerR))>30)){
                 warning("long primer (>30nt) provided are you sure about your primer sequences?")
             }
             if (length(object@primerF) != length(object@primerR)){
                 "Same number of forward and reverse primer sequences needed to constitute Primer-Pairs"}
})


##' @param primerF Character vector or DNAStringSet. Can be named or
##'     unnamed. 
##' @param primerR Character vector or DNAStringSet of the same
##'     length. Can be named or unnamed.
##' @export PrimerPairsSet
##' @rdname PrimerPairsSet-class
PrimerPairsSet <- function(primerF=character(), primerR=character(), names=character()){
    ## if names exist construct primer names
    if(length(names) >0 && length(names) != length(primerF)){
        stop("primer names must have same lenght as number of primer pairs")
    } else if(length(names) == length(primerR)){
        na <- names
    } else if(length(names(primerR)) == length(primerR) && # 
              length(names(primerF))== length(primerF)) {
        ## concatenate forward and rev name
        na <- paste0(names(primerF), ".", names(primerR)) 
    } else {
        na <- paste0(primerF, ".", primerR)
    } # otherwise use primer sequences
    ## set all names the same!
    names(primerF) <- na
    names(primerR) <- na
    new("PrimerPairsSet",
        primerF = DNAStringSet(primerF),
        primerR = DNAStringSet(primerR),
        names = na,
        .mapF = as.numeric(factor(as.character(primerF))),
        .mapR = as.numeric(factor(as.character(primerR))),
        .uniqueF = sort(unique(primerF)),
        .uniqueR = sort(unique(primerR)))
}

## Methods
##' Accessor like functions
##' \code{length} gives the number of read pairs in a
##' \code{PrimerPairsSet-class} object
##' @param x A \code{PrimerPairsSet-class} object.
##' @export
##' @rdname PrimerPairsSet-class
setMethod(length, "PrimerPairsSet", function(x) length(x@primerF))

##' \code{names} of primer-pairs (amplicons) in a
##' \code{PrimerPairsSet-class} object
##' @export
##' @rdname PrimerPairsSet-class
setMethod(names, "PrimerPairsSet", function (x) x@names)


##' The central data structure of the MultiAmplicon package
##'
##' The MultiAmplicon class is a container that stores at least primer
##' pairs, read files and progressively processed data in an 'amplicon
##' x samples' format. The slots in this object are incrementally
##' filled with by running wrappers functions (mostly around functions
##' from the \code{dada2} package). The object is treated (subsetted
##' etc.) like a (pseudo) matrix, colums are samples, rows are
##' different amplicons.
##' 
##' @slot PrimerPairsSet The primer pairs used in your experiment to
##'     specify amplicons stored in a
##'     \code{\link{PrimerPairsSet-class}} object.
##'
##' @slot PairedReadFileSet The (quality filtered) fastq files (one
##'     file pair for each sample) that store your sequencing data.
##'
##' @slot .Data A numeric matrix of sequencing read counts per
##'    amplicon and sample. Created by the function
##'    \code{\link{sortAmplicons}} in the MultiAmplicon pipeline.
##'
##' @slot sampleData A sample_data object from
##'     \code{\link[phyloseq]{phyloseq}}. The slot is created from
##'     sample names (names of the \code{\link{PrimerPairsSet}}, which
##'     have tto be the same as \code{colnames(MA)}). More data can be
##'     added by \code{\link{addSampleData}}.
##' 
##' @slot stratifiedFilesF temporary files as a result of stratifying
##'     into amplicons and samples using the MultiAmplicon pipeline
##'     function \code{\link{sortAmplicons}}. Forward (sometimes
##'     called R1) and reverse (sometimes called R2) files are stored
##'     as a (amplicons x samples) matrix objects.
##'
##' @slot stratifiedFilesR temporary files as a result of stratifying
##'     into amplicons and samples using the MultiAmplicon pipeline
##'     function \code{\link{sortAmplicons}}. Forward (sometimes
##'     called R1) and reverse (sometimes called R2) files are stored
##'     as a (amplicons x samples) matrix objects.
##'
##' @slot derep A list of \code{\link{PairedDerep-class}} objects
##'     containing pairs of derep-class objects created by
##'     \code{dada2}’s \code{\link[dada2]{derepFastq}} function or
##'     withing the MultiAmplicon pipeline by
##'     \code{\link{derepMulti}}.
##'
##' @slot dada A list of \code{\link{PairedDada-class}} object
##'     containing pairs of dada-class objects created by
##'     \code{dada2}’s \code{\link[dada2]{dada}} function. Within the
##'     MultiAmplicon pipeline this slot is filled by
##'     \code{\link{dadaMulti}}.
##'
##' @slot mergers A list of objects containing merged pairs of forward
##'     and reverse reads as created by by \code{dada2}’s
##'     \code{\link[dada2]{mergePairs}} function. Within the
##'     MultiAmplicon pipeline this slot is filled by
##'     \code{\link{mergeMulti}}.
##'
##' @slot sequenceTable A list of matrix objects created by
##'     \code{dada2}’s \code{\link[dada2]{makeSequenceTable}}.
##'     Samples (in rows) and amplified sequence variants (ASVs) in
##'     columns.  Within the MultiAmplicon pipeline this slot is
##'     filled by \code{\link{makeSequenceTableMulti}}.
##'
##' @slot sequenceTableNoChime A list of matrix objects created by
##'     \code{dada2}’s \code{\link[dada2]{removeBimeraDenovo}}.
##'     Samples (in rows) and ASVs screened for PCR chimeras in
##'     columns. Within the MultiAmplicon pipeline this slot is filled
##'     by \code{\link{removeChimeraMulti}}.
##'
##' @slot taxonTable A list of matrix objects created by a function
##'     for taxonomical annotation (for example
##'     \code{\link{blastTaxAnnot}}. The list is named with amplicon
##'     names and slots are empty (NULL) before taxon annotation is
##'     performed. Within the list elements ASVs are in rows and
##'     taxnomical ranks are in columns.
##'
##' MultiAmplicon(PrimerPairsSet, PairedReadFileSet)
##' 
##' @param PrimerPairsSet a set of primer pairs specifiying your
##'     amplicons see \code{\link{PrimerPairsSet-class}}
##' 
##' @param PairedReadFileSet a set of paired end sequencing data files
##'     \code{\link{PairedReadFileSet-class}}
##'
##' @param .Data Users should not supply this parameter, the slot
##'     is created by \code{\link{sortAmplicons}}.
##'
##' @param sampleData Users should not supply this parameter. It's
##'     filled with a sample_data object from
##'     \code{\link[phyloseq]{phyloseq}}. The slot is created from
##'     sample names (same as \code{colnames(MA)}) and more data can
##'     be added by \code{\link{addSampleData}}.
##'
##' @param stratifiedFiles Users should not supply this parameter, the
##'     slot is created by \code{\link{sortAmplicons}}.
##'
##' @param derep Users should not supply this parameter, the slot is
##'     created by \code{\link{derepMulti}}
##'
##' @param dada Users should not supply this parameter, the slot is
##'     created by \code{\link{dadaMulti}}
##' 
##' @param mergers Users should not supply this parameter, the slot is
##'     created by \code{\link{mergeMulti}}
##'
##' @param sequenceTable Users should not supply this parameter, the
##'     slot is created by \code{\link{makeSequenceTableMulti}}
##'
##' @param sequenceTableNoChime Users should not supply this parameter,
##'     the slot is created by \code{\link{removeChimeraMulti}}
##'
##' @param taxonTable Users should not supply this parameter, the slot
##'     is created by \code{\link{blastTaxAnnot}}. It's filled with a
##'     list of taxonomyTable objects from
##'     \code{\link[phyloseq]{phyloseq}}.
##' 
##' @examples
##'
##' primerF <- c("AGAGTTTGATCCTGGCTCAG", "ACTCCTACGGGAGGCAGC",
##'             "GAATTGACGGAAGGGCACC", "YGGTGRTGCATGGCCGYT")
##' primerR <- c("CTGCWGCCNCCCGTAGG", "GACTACHVGGGTATCTAATCC",
##'              "AAGGGCATCACAGACCTGTTAT", "TCCTTCTGCAGGTTCACCTAC")
##'
##' PPS <- PrimerPairsSet(primerF, primerR)
##' 
##' fastq.dir <- system.file("extdata", "fastq", package = "MultiAmplicon")
##' fastq.files <- list.files(fastq.dir, full.names=TRUE)
##' Ffastq.file <- fastq.files[grepl("F_filt", fastq.files)]
##' Rfastq.file <- fastq.files[grepl("R_filt", fastq.files)]
##'
##' PRF <- PairedReadFileSet(Ffastq.file, Rfastq.file)
##'
##' MA <- MultiAmplicon(PPS, PRF)
##'
##' ## sort into amplicons
##' MA1 <- sortAmplicons(MA, filedir=tempfile(pattern = "dir"))
##'
##' ## Only after sorting the MultiAmplicon object is really poplated
##' ## with sensible data, now matrix-like access to different 
##' ## amplicons (primer pairs) and different sequencing read files
##' ## (usually samples) is implemented.
##' 
##' ## the number of amplicons (primer pairs)
##' nrow(MA)
##'
##' ## the number of samples (sequencing read file pairs)
##' ncol(MA)
##' 
##' ## dereplication is currently not supported
##' ## MA2 <- derepMulti(MA1)
##'
##' ### use dada directly after sorting
##' MA3 <- dadaMulti(MA1, selfConsist = TRUE)
##'
##' MA4 <- mergeMulti(MA3, justConcatenate=TRUE)
##'
##' MA5 <- makeSequenceTableMulti(MA4)
##'
##' MA6 <- removeChimeraMulti(MA5, mc.cores=1)
##'
##' @seealso \code{\link[dada2]{derepFastq}},\code{\link[dada2]{dada}}
##' @importFrom dada2 derepFastq dada
##' @importClassesFrom phyloseq sample_data
##' @author Emanuel Heitlinger
##' @exportClass MultiAmplicon
setClass("MultiAmplicon",
         representation(PrimerPairsSet="PrimerPairsSet",
                        PairedReadFileSet="PairedReadFileSet",
                        sampleData="sample_data", 
                        rawCounts="matrix",
                        stratifiedFilesF="matrix",
                        stratifiedFilesR="matrix",
                        derepF="matrix",
                        derepR="matrix",
                        dadaF="matrix", 
                        dadaR="matrix",
                        mergers="matrix",
                        sequenceTable="list",
                        sequenceTableNoChime="list",
                        taxonTable="list"),
                        contains="matrix",
         validity=function(object) {
             ## constructors check for PairedReadFileSet,
             ## PrimerPairsSet, rawCounts and sampleData
             ## directly. Other slots are list can additionally be
             ## checked at deeper levels
             if(!all(colnames(object)%in%rownames(getSampleData(object)))){
                  "Sample names of SampleData must be equal colhmn names of  MultiAmplicon object"
             }
             if(.isListOf(getDadaF(object), "dada", nullOk=TRUE)){
                 "PairedDada objects or an empty list must be provided for a valid MultiAmplicon object"
             }
             if(.isListOf(getDadaR(object), "dada", nullOk=TRUE)){
                 "PairedDada objects or an empty list must be provided for a valid MultiAmplicon object"
             }
             ## if(!all(unlist(lapply(object@derep, .isListOf, "PairedDerep")))){
             ##     "PairedDerep objects or an empty list must be provided for a valid MultiAmplicon object"
             ## }
             ## if(!all(unlist(lapply(object@mergers, .isListOf, "data.frame")))){
             ##     "data.frame objects or an empty list must be provided for valid mergers in MultiAmplicon object"
             ## }
             if(!.isListOf(object@sequenceTable, "matrix")){
                 "matrix objects or an empty list must be provided for valid sequenceTables in MultiAmplicon object"
             }
             if(!.isListOf(object@sequenceTableNoChime, "matrix")){
                     "matrix objects or an empty list must be provided for valid sequenceTableNoChime in MultiAmplicon object"
             }
             if(!.isListOf(object@taxonTable, "taxonomyTable", nullOk=TRUE)){
                 "taxonomyTable objects or an empty list must be provided in MultiAmplicon object"
             }
         }
         )


##' @export MultiAmplicon
##' @describeIn MultiAmplicon-class Constructor for
##'     MultiAmplicon-class
MultiAmplicon <- function(PrimerPairsSet = PrimerPairsSet(),
                          PairedReadFileSet = PairedReadFileSet(),
                          sampleData = new("sample_data",
                                           data.frame(row.names=names(PairedReadFileSet),
                                                      readsF=PairedReadFileSet@readsF,
                                                      readsR=PairedReadFileSet@readsF)),
                          .Data = matrix(seq(1, length(PrimerPairsSet) *
                                                length(PairedReadFileSet)),
                                         nrow=length(PrimerPairsSet),
                                         ncol=length(PairedReadFileSet),
                                         dimnames=list(names(PrimerPairsSet),
                                                       names(PairedReadFileSet))
                                         ),
                          stratifiedFilesF = matrix(nrow=0, ncol=0),
                          stratifiedFilesR =matrix(nrow=0, ncol=0),
                          rawCounts = matrix(nrow=0, ncol=0),
                          derepF = matrix(nrow=0, ncol=0),
                          derepR = matrix(nrow=0, ncol=0),
                          dadaF = matrix(nrow=0, ncol=0),
                          dadaR = matrix(nrow=0, ncol=0),
                          mergers = matrix(nrow=0, ncol=0),
                          sequenceTable =
                              sapply(names(PrimerPairsSet),function(x) NULL),
                          sequenceTableNoChime =
                              sapply(names(PrimerPairsSet),function(x) NULL),
                          taxonTable =
                              sapply(names(PrimerPairsSet),function(x) NULL)
                          ){
    new("MultiAmplicon",
        .Data = .Data,
        PrimerPairsSet = PrimerPairsSet,
        PairedReadFileSet = PairedReadFileSet,
        sampleData = sampleData,
        stratifiedFilesF = stratifiedFilesF,
        stratifiedFilesR = stratifiedFilesR,
        rawCounts = rawCounts,
        derepF = derepF,
        derepR = derepR,
        dadaF = dadaF,
        dadaR = dadaR,
        mergers = mergers,
        sequenceTable = sequenceTable,
        sequenceTableNoChime = sequenceTableNoChime,
        taxonTable = taxonTable
        )
}

### ## NOTE TO MYSELF: in the longer term CONSIDER changing the data
### ## structure of empty slots to contain zeros. This would make
### ## handling of the objects more straigth forward

### ## matrix(0, nrow=length(PrimerPairsSet),
### ## ncol=length(PairedReadFileSet) vector("list",
### ## length=length(PrimerPairsSet))


##' @rdname MultiAmplicon-class
##' @param MA MultiAmplicon-class object
##' @export
getPrimerPairsSet <- function (MA) slot(MA, "PrimerPairsSet")


##' @rdname MultiAmplicon-class
##' @param MA MultiAmplicon-class object
##' @export
getPairedReadFileSet <- function (MA) slot(MA, "PairedReadFileSet")


##' @rdname MultiAmplicon-class
##' @param MA MultiAmplicon-class object
##' @export
getRawCounts <- function (MA) {
    return(slot(MA, "rawCounts"))
}

##' @rdname MultiAmplicon-class
##' @param MA MultiAmplicon-class object
##' @export
getSampleData <- function (MA) {
    return(slot(MA, "sampleData"))
}

.getSlot <- function(MA, slot, dropEmpty=TRUE, name=TRUE){
    x <- slot(MA, slot)
    if(all(dim(x)==0)||is.null(dim(x))) return(x)
    if (dropEmpty) {
        exists <- which(getRawCounts(MA) > 0)
        exi <- x[exists]
        if (isTRUE(name)){
            if(all(dim(x)>1)){
                n.exi <- apply(expand.grid(rownames(MA), colnames(MA)),
                               1, paste, collapse="|")
            } else if(nrow(x)==1){
                n.exi <- colnames(x)
            } else if(ncol(x)==1){
                n.exi <- rownames(x)
            } else {
                stop(paste("dimension error when extracting", slot))
            }
            names(exi) <- n.exi[exists]
        }
        return(exi)
    } else {return(x)}
}


##' @rdname MultiAmplicon-class
##' @param dropEmpty Should empty files be returned
##' @export
getStratifiedFilesF <- function(MA,  ...) {
    .getSlot(MA, "stratifiedFilesF", ...)
}

##' @rdname MultiAmplicon-class
##' @param dropEmpty Should empty files be returned
##' @export
getStratifiedFilesR <- function(MA, ...) {
    .getSlot(MA,  "stratifiedFilesR", ...)
}

##' @rdname MultiAmplicon-class
##' @export
getDerepF <-  function(MA, ...) {
    .getSlot(MA, "derepF", ...)
}

##' @rdname MultiAmplicon-class
##' @export
getDerepR <-  function(MA, ...) {
    .getSlot(MA, "derepR", ...)
}

##' @rdname MultiAmplicon-class
##' @export
getDadaF <- function(MA, ...) {
    .getSlot(MA, "dadaF", ...)
}

##' @rdname MultiAmplicon-class
##' @export
getDadaR <- function(MA, ...) {
    .getSlot(MA, "dadaR", ...)
}

##' @rdname MultiAmplicon-class
##' @export
getMergers <- function(MA, ...) {
    .getSlot(MA, "mergers", ...)
}

##' @rdname MultiAmplicon-class
##' @export
getSequenceTable <- function(MA, dropEmpty=TRUE, simplify=TRUE){
    ST <- MA@sequenceTable
    if(!dropEmpty) {
        ST <- lapply(ST, .fillSampleTables, colnames(MA))
    }
    .simpfy(ST, simplify)
}

##' @rdname MultiAmplicon-class
##' @export
getSequenceTableNoChime <- function(MA, dropEmpty=TRUE, fill=FALSE){
    STC <- MA@sequenceTableNoChime
    if(!dropEmpty) {
        STC <- lapply(STC, .fillSampleTables, colnames(MA))
    }
    .simpfy(STC, simplify)
}

##' @rdname MultiAmplicon-class
##' @export
getTaxonTable <- function(MA, simplify=TRUE){
    .simpfy(MA@taxonTable, simplify)
}

##' @rdname MultiAmplicon-class
##' @export
setGeneric("getSequencesFromTable", function(MA) {standardGeneric("getSequencesFromTable")})

##' @rdname MultiAmplicon-class
##' @importFrom dada2 getSequences
##' @export
setMethod("getSequencesFromTable", "MultiAmplicon",
          function (MA) {
              lapply(getSequenceTableNoChime(MA), function (y) {
                  if(!is.null(dim(y)) && all(dim(y)>1)) {
                      getSequences(y)}
                  else NULL
              })
          })

.simpfy <- function(x, simplify) {
    if(length(x)==1 && simplify){
        x[[1]]
    } else{x}
}
    

.isListOf <- function (x, what, nullOk=FALSE){
    if(nullOk) {
        what <- c(what, "NULL")
    }
    if(!is.list(x)){
        return(FALSE)
    }
    else{
        classes <- unlist(lapply(x, class))
        all(classes%in%what)
    }
}


##' @rdname MultiAmplicon-class
##' @export
setMethod("apply", signature(X = "MultiAmplicon",
                             MARGIN = "numeric",
                             FUN = "function"),
          function (X, MARGIN, FUN, ...) {
              if (length(MARGIN)>1){
                  stop("MARGIN > 1 not supported for MultiAmplicon objects.\n")
              }
              FUN <- match.fun(FUN)
              dn.ans <- dimnames(X)[MARGIN]
              if (MARGIN==1) {
                  rowRes <- sapply(seq(nrow(X)), function (i){
                      FUN(X[i, ], ... )
                  })
                  names(rowRes) <- rownames(X)
                  rowRes
              } else {
                  if (MARGIN==2) {
                      colRes <- sapply(seq(ncol(X)), function (j){
                          FUN(X[, j], ... )
                      })
                      names(colRes) <- colnames(X)
                      colRes
                  } else {
                      stop("Only MARGIN of 1 or 2 supported for a MultiAmplicon object.\n")
                  }
              }
          })



## Prevent R CMD check from complaining about the use of pipe expressions
## standard data.table variables
if (getRversion() >= "2.15.1")
    utils::globalVariables(c(".", ".I", ".N", ".SD",
                             "query", "subject", "pident",
                             "length", "mismatch",
                             "gapopen", "qstart", "qend", "sstart", "send",
                             "evalue",  "bitscore", "staxid",
                             "qtaxid", "bitsum", "ampProd",
                             "superkingdom", "phylum", "class", "order", "family",
                             "genus", "species"), utils::packageName(), add=FALSE)

## Make sure data.table knows we know we're using it
.datatable.aware = TRUE
derele/MultiAmplicon documentation built on Dec. 11, 2024, 12:09 p.m.