remove_adapters: Interface to bowtie2 of adapterremoval-2.2.1a
In Rbowtie2: An R Wrapper for Bowtie2 and AdapterRemoval

Description Usage Arguments Details Value Author(s) References Examples

View source: R/adapterremoval.R

This function can be use to call wrapped AdapterRemoval binary.

1
2
3

remove_adapters(file1, ..., adapter1 = NULL, output1 = NULL, file2 = NULL,
  adapter2 = NULL, output2 = NULL, basename = NULL, interleaved = FALSE,
  overwrite = FALSE)

`file1`	`Character` vector. For single-end sequencing, it contains sequence file paths. For paired-end sequencing, it can be file paths with #1 mates paired with file paths in file2 And it can also be interleaved file paths when argument interleaved=`TRUE`
`...`	Additional arguments to be passed on to the binaries. See below for details.
`adapter1`	`Character`. It is an adapter sequence for file1. Default: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
`output1`	`Character`. The trimmed mate1 reads output file path for file1. Defualt: basename.pair1.truncated (paired-end), basename.truncated (single-end), or basename.paired.truncated (interleaved)
`file2`	`Character` vector. It contains file paths with #2 mates paired with file paths in file1. For single-end sequencing files and interleaved paired-end sequencing files(argument interleaved=`TRUE`), it must be `NULL`.
`adapter2`	`Character`. It is an adapter sequence for file2. Defualt: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
`output2`	`Character`. The trimmed mate2 reads output file path for file2. Default: BASENAME.pair2.truncated (only used in PE mode, but not if –interleaved-output is enabled)
`basename`	`Character`. The outputfile path prefix. Default: your_output
`interleaved`	`Logical`. Set `TRUE` when files are interleaved paired-end sequencing data.
`overwrite`	`Logical`. Force overwriting of existing files if setting `TRUE`.

All additional arguments in ... are interpreted as additional parameters to be passed on to remove_adapters. All of them should be Character or Numeric scalar. You can put all aditional arguments in one Character(e.g. "–threads 8") with white space splited just like command line, or put them in different Character(e.g. "–threads","8"). Note that some arguments( "–file1","–file2","–adapter1","–adapter2","–output1","–output2", "–basename","–interleaved") to the identify_adapters are invalid if they are already handled as explicit function arguments. See the output of adapterremoval_usage() for details about available parameters.

An invisible Integer of call status. The value is 0 when there is not any mistake. Otherwise the value is non-zero.

Zheng Wei

Schubert, Lindgreen, and Orlando (2016). AdapterRemoval v2: rapid adapter trimming, identification, and read merging. BMC Research Notes, 12;9(1):88.

td <- tempdir()

# Identify adapters
reads_1 <- system.file(package="Rbowtie2", "extdata", "adrm", "reads_1.fq")
reads_2 <- system.file(package="Rbowtie2", "extdata", "adrm", "reads_2.fq")
adapters <- identify_adapters(file1=reads_1,file2=reads_2,
basename=file.path(td,"reads"), "--threads 3",overwrite=TRUE)

# Remove adapters
cmdout<-remove_adapters(file1=reads_1,file2=reads_2,adapter1 = adapters[1],
adapter2 = adapters[2],
output1=file.path(td,"reads_1.trimmed.fq"),
output2=file.path(td,"reads_2.trimmed.fq"),
basename=file.path(td,"reads.base"),overwrite=TRUE,"--threads 3");cmdout