writeHits: Write the hits of sequence search from a sequence to a file

In CRISPRseek: Design of target-specific guide RNAs in CRISPR-Cas9, genome-editing systems

Description

write the hits of sequence search from a sequence instead of BSgenome to a file, internal function used by searchHits

Usage

writeHits(gRNA, seqname, matches, strand, file, gRNA.size = 20L,
     PAM = "NGG", PAM.pattern = "N[A|G]G$", max.mismatch = 4L,
     chrom.len, append = FALSE, PAM.location = "3prime", 
     PAM.size = 3L, allowed.mismatch.PAM = 1L,
     seqs,
    baseEditing = FALSE, targetBase = "C", editingWindow = 4:8)

Arguments

gRNA	DNAString object with gRNA sequence with PAM appended immediately after,e.g., ACGTACGTACGTACTGACGTCGG with 20bp gRNA sequence plus 3bp PAM sequence CGG
seqname	sequence name as character
matches	XStringViews object storing matched chromosome locations
strand	strand of the match, + for plus strand and - for minus strand
file	file path where the hits is written to
gRNA.size	gRNA size, default 20
PAM	PAM as regular expression for appending to the gRNA, default NGG for SpCas9, change to TTTN for cpf1.
PAM.pattern	PAM as regular expression for filtering the hits, default N[A|G]G$ for spCas9. For cpf1, ^TTTN since it is a 5 prime PAM sequence.
max.mismatch	maximum mismatch allowed within the gRNA (excluding PAM portion) for filtering the hits, default 4
chrom.len	length of the matched chromosome
append	TRUE if append to existing file, false if start a new file
PAM.location	PAM location relative to gRNA. For example, spCas9 PAM is located on the 3 prime while cpf1 PAM is located on the 5 prime
PAM.size	Size of PAM, default 3
allowed.mismatch.PAM	Maximum number of mismatches allowed in the offtargets comparing to the PAM sequence. Default to 1 for NGG PAM
seqs	DNAString object containing a DNA sequence.
baseEditing	Indicate whether to design gRNAs for base editing. Default to FALSE If TRUE, please set baseEditing = TRUE, targetBase and editingWidow accordingly.
targetBase	Applicable only when baseEditing is set to TRUE. It is used to indicate the target base for base editing systems, default to C for converting C to T in the CBE system. Please change it to A if you intend to use the ABE system.
editingWindow	Applicable only when baseEditing is set to TRUE. It is used to indicate the effective editing window to consider for the offtargets search only, default to 4 to 8 which is for the original CBE system. Please change it accordingly if the system you use have a different editing window, or you would like to include offtargets with the target base in a larger editing window.

Value

results are saved in the file specified by file

Author(s)

Lihua Julie Zhu

References

http://bioconductor.org/packages/2.8/bioc/vignettes/BSgenome/inst/doc/ GenomeSearching.pdf

See Also

offTargetAnalysis

Examples

 if(interactive())
 {
    gRNAPlusPAM <- DNAString("ACGTACGTACGTACTGACGTCGG")
    x <- DNAString("AAGCGCGATATGACGTACGTACGTACTGACGTCGG")
    chrom.len <- nchar(as.character(x))
    m <- matchPattern(gRNAPlusPAM, x)
    names(m) <- "testing"
    writeHits(gRNA = gRNAPlusPAM, seqname = "chr1", 
        matches = m, strand = "+", file = "exampleWriteHits.txt", 
        chrom.len = chrom.len, append = FALSE)
 }

CRISPRseek documentation built on Jan. 14, 2021, 2:50 a.m.