searchAln-methods: searchAln method

In ge11232002/TFBSTools: Software Package for Transcription Factor Binding Site (TFBS) Analysis

Description

Scans a pairwise alignment of nucleotide sequences with the pattern represented by the PWMatrix. It reports only those hits that are overlapped in the alignment of of the two sequences and exceed a specified threshold score in both, AND are found in regions of the alignment above the specified conservation cutoff value.

Usage

  searchAln(pwm, aln1, aln2, seqname1="Unknown1", seqname2="Unknown2",
            min.score="80%", windowSize=51L, 
            cutoff=0.7, strand="*", type="any", conservation=NULL,
            mc.cores=1L)

Arguments

pwm	A PWMatrix object or a PWMatrixList object.
aln1	A DNAString, character, DNAStringSet or Axt object can be used to represent the pairwise alignment. When the last two objects are used and have a length of 2, the argument aln2 can be missing.
aln2	A DNAString, character. It can be missing when aln1 is DNAStringSet or Axt object.
seqname1,seqname2	A chracter object for the name of sequence. "Unknown1" and "Unknown2" are used by default. These two arguments are ignored when aln1 is Axt, or the seqnames are available from aln1.
min.score	The minimum score for the hit. Can be given an character string in the format of "80%" or as a single absolute value. When it is percentage value, it means the percentage of the maximal possible from the PWM.
windowSize	The size of the sliding window (in nucleotides) for calculating local conservation in the alignment. This should be an odd value.
cutoff	The conservation cutoff can be from 0 (0% identity) to 1 (100% identity). The regions which have lower conservation than the cutoff will be discarded from the results of the pattern searching. The conservation is calculated by comparing the alignments within the windowSize: 1 for match and 0 for mismatch and gap.
strand	When searching the alignment, we can search the positive strand or negative strand. While strand is "*", it will search both strands and return the results based on the positvie strand coordinate.
type	This argument can be "any" or "all". When it is "any", one motif will be kept if the maximal conservation value of the motif is larger than the cutoff. When it is "all", one motif will be kept if the minimal conservation value of the motif is larger than the cutoff.
conservation	A vector of conservation profile. If not supplied, the conservation profile will be computed internally on the fly.
mc.cores	The number of cpu threads to use when searching Axt. 1L is assigned by default.

Details

In brief, given a pairwise alignment of two sequences, first of all, we remove the gaps ("-", "-", "."). Then we scan both ungapped sequences with the pwm and return the hits that above min.score. Since we only want to keep the conserved hits, we choose the pair of motifs that overlap most in the alignment. Finally, the pair of motifs have to be conserved above the threshold cutoff.

In the returned SitePairSet, the coordinates of start, end are based on the ungapped sequences, instead of the original alignment. This is due to we are more concerned about the actual location of motif in the genome rather than in the alignment.

Value

A SitePairSet object is returned when pwm is a PWMatrix, while a SitePairSetList is returned when pwm is a PWMatrixList.

Author(s)

Ge Tan

See Also

searchSeq

Examples

  data(MA0003.2)
  data(MA0004.1)
  pwm1 <- toPWM(MA0003.2)
  pwm2 <- toPWM(MA0004.1)
  pwmList <- PWMatrixList(pwm1=pwm1, pwm2=pwm2)
  # Two character objects
  aln1 <- "ACCACATTGCCTCAGGGCAGGTAAGTTGATC---AAAGG---AAACGCAAAGTTTTCAAG"
  aln2 <- "GTTTCACTACATTGCTTCAGGGCAGTAAATATATAAATATATAAAAATATAATTTTCATC"
  aln <- c(aln1=aln1, aln2=aln2)
  library(Biostrings)
  alnDNAStringSet <- DNAStringSet(c(aln1=aln1, aln2=aln2))
  
  # PWMatrix, character, character
  ## Only scan the positive strand of the alignments
  sitePairSet <- searchAln(pwm1, aln1, aln2, seqname1="aln1", seqname2="aln2",
                           min.score="70%", cutoff=0.5, 
                           strand="+", type="any")
  ## Only scan the negative strand of the alignments
  sitePairSet <- searchAln(pwm1, aln1, aln2, seqname1="aln1", seqname2="aln2",
                           min.score="70%", cutoff=0.5, 
                           strand="-", type="any")
  ## Scan the both strands of the alignments                         
  sitePairSet <- searchAln(pwm1, aln1, aln2, seqname1="aln1", seqname2="aln2",
                           min.score="70%", cutoff=0.5, 
                           strand="*", type="any")
  ## Convert the SitePairSet object into other R objects
  as(sitePairSet, "data.frame")
  as.data.frame(sitePairSet)
  as(sitePairSet, "DataFrame")
  as(sitePairSet, "GRanges")
  writeGFF3(sitePairSet)
  writeGFF2(sitePairSet)
  
  # PWMatrix, character, missing
  sitePairSet <- searchAln(pwm1, aln,
                           min.score="70%", cutoff=0.5, 
                           strand="*", type="any")
  
  # PWMatrix, DNAString, DNAString
  sitePairSet <- searchAln(pwm1, DNAString(aln1), DNAString(aln2), 
                           seqname1="aln1", seqname2="aln2",
                           min.score="70%", cutoff=0.5, 
                           strand="*", type="any")

  # PWMatrix, DNAStringSet, missing
  sitePairSet <- searchAln(pwm1, alnDNAStringSet,
                           min.score="70%", cutoff=0.5, 
                           strand="*", type="any")
                           
  # PWMatrixList, character, character
  sitePairSetList <- searchAln(pwmList, aln1, aln2, 
                           seqname1="aln1", seqname2="aln2",
                           min.score="70%", cutoff=0.5, 
                           strand="*", type="any")
  ## elementLenths of each pwm hits
   elementNROWS(sitePairSetList)
                           
  ## output
  writeGFF2(sitePairSetList)
  writeGFF3(sitePairSetList)
  as(sitePairSetList, "DataFrame")
  as(sitePairSetList, "data.frame")
  as.data.frame(sitePairSetList)
  as(sitePairSetList, "GRanges")
  
  # PWMatrix, Axt, missing
  library(CNEr)
  axtFilesHg19DanRer7 <- file.path(system.file("extdata", package="TFBSTools"), 
                                   "hg19.danRer7.net.axt")
  axtHg19DanRer7 <- readAxt(axtFilesHg19DanRer7)
  sitePairSetList <-  searchAln(pwm1, axtHg19DanRer7, min.score="80%", 
                            windowSize=51L, cutoff=0.7, strand="*", 
                            type="any", conservation=NULL, mc.cores=1)
  ## We may want to coordinates of motif in the genome
  GRangesTFBS <- toGRangesList(sitePairSetList, axtHg19DanRer7)

ge11232002/TFBSTools documentation built on Sept. 12, 2021, 12:07 p.m.