## test file for use whith testthat
primerF <- c(Amp1F = "AGAGTTTGATCCTGGCTCAG", Amp2F = "ACTCCTACGGGAGGCAGC",
Amp3F = "GAATTGACGGAAGGGCACC", Amp4F = "YGGTGRTGCATGGCCGYT",
Amp5F = "AAAAACCCCGGGGGGTTTTT", Amp6F = "AGAGTTTGATCCTGCCTCAG")
primerR <- c(Amp1R = "CTGCWGCCNCCCGTAGG", Amp2R = "GACTACHVGGGTATCTAATCC",
Amp3R = "AAGGGCATCACAGACCTGTTAT", Amp4R = "TCCTTCTGCAGGTTCACCTAC",
Amp5R = "AAAAACCCCGGGGGGTTTTT", Amp6R = "CCTACGGGTGGCAGATGCAG")
PPS <- PrimerPairsSet(primerF, primerR)
fastq.dir <- system.file("extdata", "fastq", package = "MultiAmplicon")
fastq.files <- list.files(fastq.dir, full.names=TRUE)
Ffastq.file <- fastq.files[grepl("F_filt", fastq.files)]
Rfastq.file <- fastq.files[grepl("R_filt", fastq.files)]
PRF <- PairedReadFileSet(Ffastq.file, Rfastq.file)
MA <- MultiAmplicon(PPS, PRF)
SA <- MultiAmplicon(PrimerPairsSet(primerF[1], primerR[1]), PRF)
SA1 <- sortAmplicons(SA, filedir=tempfile())
MA1 <- sortAmplicons(MA, filedir=tempfile())
context("Does read sorting work?")
test_that("no reads were sorted into different samples" , {
## Test read confusion in the read sorting. Think about making this
## available to the user with a warning that it's compute intesive
trackReadSorting <- function (MA) {
readsFL <- lapply(seq_along(MA@PairedReadFileSet), function(i) {
rawFiles <- MA@PairedReadFileSet@readsF[[i]]
rawFiles <- rawFiles[which(file.exists(rawFiles))]
ShortRead::readFastq(rawFiles)
})
snames <- colnames(MA)
names(readsFL) <- snames
sort_track <- lapply(snames, function (sampl) {
strat <- lapply(getStratifiedFilesF(MA), function(x) {
grep(sampl, x, value=TRUE)
})
readsF_stratified <- ShortRead::readFastq(unlist(strat))
IDsStrat <- ShortRead::id(readsF_stratified)
readsF <- readsFL[[sampl]]
IDsRaw <- ShortRead::id(readsF)
cbind(RawReads = length(readsF),
UniqueRawReads = length(unique(IDsRaw)),
SortedReads = length(readsF_stratified),
UniqueSortedReads = length(unique(IDsStrat)),
Problems = length(IDsStrat[which(!as.vector(IDsStrat) %in%
as.vector(IDsRaw))])
)
})
sort_track <- as.data.frame(do.call(rbind, sort_track))
base::rownames(sort_track) <- snames
sort_track$DuplicateRaw <- sort_track$RawReads -
sort_track$UniqueRawReads
sort_track$DuplicateSorted <- sort_track$SortedReads -
sort_track$UniqueSortedReads
sort_track
}
sortingStats <- trackReadSorting(MA1)
cat("\n\n Read sorting statistics\n")
print(sortingStats)
cat("\n\n")
## has the table been generated with the proper column
expect_gt(length(sortingStats$Problems), 0)
## are there no sorting problems
expect_equal(sum(sortingStats$Problems), 0)
## and are thery the sam for replicated samples
expect_equal(unname(t(sortingStats["S05_F_filt.fastq.gz", ])),
unname(t(sortingStats["S05D_F_filt.fastq.gz", ])))
})
test_that("rowCounts is zero for empty file", {
## For multi amplicon objects
expect_equal(colSums(getRawCounts(MA1))[["S00_F_filt.fastq.gz"]], 0)
## For single amplicon objects
expect_equal(colSums(getRawCounts(SA1))[["S00_F_filt.fastq.gz"]], 0)
})
test_that("rowCounts is zero for nonsensical primer", {
## For multi amplicon objects
expect_equal(rowSums(getRawCounts(MA1))[["Amp5F.Amp5R"]], 0)
## For single amplicon objects ... no empty amplicon used
## expect_equal(rowSums(getRawCounts(SA1))[["Amp5F.Amp5R"]], 0)
})
## get only non empty samples raw counts
test_that("number of files written equals non-zero samples in rawCounts", {
## For multi amplicon objects
F.files <- unlist(getStratifiedFilesF(MA1))
R.files <- unlist(getStratifiedFilesR(MA1))
expect_equal(sum(getRawCounts(MA1)>0), length(F.files))
expect_equal(sum(getRawCounts(MA1)>0), length(R.files))
## For single amplicon objects
F.files <- unlist(getStratifiedFilesF(SA1))
R.files <- unlist(getStratifiedFilesR(SA1))
expect_equal(sum(getRawCounts(SA1)>0), length(F.files))
expect_equal(sum(getRawCounts(SA1)>0), length(R.files))
})
test_that("files for each amplicon contain the number of reads reported", {
## For multi amplicon objects
expect_equivalent(
lapply(seq(nrow(MA1)), function (i){
length(ShortRead::readFastq(getStratifiedFilesF(MA1[i, ])))
}),
rowSums(getRawCounts(MA1)))
})
test_that("files for each sample contain the number of reads reported", {
## For multi amplicon objects
expect_equivalent(
lapply(seq(ncol(MA1)), function (i){
length(ShortRead::readFastq(getStratifiedFilesF(MA1[, i])))
}),
colSums(getRawCounts(MA1)))
})
context("SortAmplcion can be made less stringent?")
test_that("less stringent sorting results in more reads accepted", {
expect_true(all(sortAmplicons(MA, filedir=tempfile(), countOnly=TRUE,
starting.at=1:2) >=
getRawCounts(MA1)))
expect_true(all(sortAmplicons(MA, filedir=tempfile(), countOnly=TRUE,
max.mismatch=1) >=
getRawCounts(MA1)))
})
context("Dereping?")
MAderep <- derepMulti(MA1)
## ## This should work, but doesn't!!! ToDO!!
## MAderepSingle <- derepMulti(MA1[1,])
## MAderepSingle <- derepMulti(MA1[6, ])
context("Dada denoising?")
MAdadaDirect <- dadaMulti(MA1, selfConsist=TRUE, pool=FALSE,
multithread=TRUE)
MAdadaDerep <- dadaMulti(MAderep, selfConsist=TRUE, pool=FALSE,
multithread=TRUE)
test_that("Denoising returns a matrix of dada object, and a list of non-empty objects?", {
## put this also in validity methods!!!???
expect_equal(getDadaF(MAdadaDirect), getDadaF(MAdadaDerep))
expect_equal(getDadaF(MAdadaDirect, dropEmpty=FALSE),
getDadaF(MAdadaDerep, dropEmpty=FALSE))
expect_true(all(c("matrix","array") %in%
class(getDadaF(MAdadaDirect, dropEmpty=FALSE))))
expect_true(class(getDadaF(MAdadaDirect, dropEmpty=TRUE)) == "list")
expect_true(.isListOf(c(getDadaF(MAdadaDirect)), "dada", nullOk=FALSE))
expect_false(.isListOf(c(getDadaF(MAdadaDirect, dropEmpty=FALSE)),
"dada", nullOk=FALSE))
expect_true(.isListOf(c(getDadaF(MAdadaDirect, dropEmpty=TRUE)),
"dada", nullOk=FALSE))
expect_equal(dim(getDadaF(MAdadaDirect, dropEmpty=FALSE)),
dim(getRawCounts(MAdadaDirect)))
expect_equal(length(getDadaF(MAdadaDirect)),
length(getStratifiedFilesF(MAdadaDirect)))
expect_equal(sapply(getDadaF(MAdadaDirect, dropEmpty=FALSE), is.null),
sapply(getRawCounts(MAdadaDirect), "==", 0))
})
test_that("dada2 denoising produces identical results for replicate samplesd", {
expect_equal(getDadaF(MAdadaDirect[, "S05_F_filt.fastq.gz"]),
getDadaF(MAdadaDirect[, "S05D_F_filt.fastq.gz"]))
})
MA4 <- mergeMulti(MAdadaDerep, justConcatenate=TRUE)
## ## the one sequence dereps have been problematic! As the names are
## ## dropped when those are "unlisted" by dada
## getDerepF(MA4["Amp6F.Amp6R", ])
## getDadaF(MA4["Amp6F.Amp6R", ]) getMergers(MA4["Amp6F.Amp6R", ])
### have to test the paramet split seperately!
## c(TRUE, FALSE), verbose=FALSE, maxMismatch = c(15, 20, 18))
context("Merging works?")
test_that("merging produces a list of derep objects ", {
expect_equal(dim(getMergers(MA4, dropEmpty=FALSE)), dim(MAdadaDerep))
})
## for some weird reason this fails (only on TravisCI) NO IDEA WHY
context("Merging works?")
test_that("proportion of merged is between zero and one ", {
expect_true(
all((calcPropMerged(MA4) >= 0 & calcPropMerged(MA4) <= 1))
)
})
test_that("all sequences are dereplicated ", {
up1.dadas <- unlist(lapply(getDadaF(MAdadaDerep), function (x){
sum(getUniques(x))
}))
up1.dereps <- unlist(lapply(getDerepF(MAdadaDerep), function (x){
sum(getUniques(x))
}))
up1.mergers <- unlist(lapply(getMergers(MA4), function (x){
sum(getUniques(x))
}))
up1.counts <- getRawCounts(MAdadaDerep)[getRawCounts(MAdadaDerep)>0]
expect_equal(up1.dereps, up1.counts)
## somehow calling dada directly on the stratified files makes the
## uniques
expect_true(all(up1.dadas<=up1.counts))
expect_true(all(up1.mergers<=up1.dadas))
})
### TODO: make pipeline tracking use getUniques and the like to get
### matrices of counts for everything systematically...
MA5 <- makeSequenceTableMulti(MA4)
MA6 <- removeChimeraMulti(MA5)
### TODO: make a test that compares the table rownames (samples) with
### names of non-zero MA columns
test_that("Identical files produce identical NoChime sequence tables ", {
lapply(MA6@sequenceTableNoChime, function(x) {
if("S05_F_filt.fastq.gz" %in% base::rownames(x)){
expect_equal(
unname(t(x["S05_F_filt.fastq.gz", ])),
unname(t(x["S05D_F_filt.fastq.gz", ])))
}
})
})
test_that("Reads in sequence tables map to stratified files", {
### these funcitons are candicates for making them available in
### the package itself
mapReadsStratTab <- function(MA) {
getReadsBySample <- function(MA){
sreads <- lapply(colnames(MA), function (sampl) {
strat <- lapply(getStratifiedFilesF(MA), function(x) {
grep(sampl, x, value=TRUE)
})
ShortRead::readFastq(unlist(strat))
})
names(sreads) <- colnames(MA)
sreads
}
RbyS <- getReadsBySample(MA)
RbyS <- lapply(RbyS, ShortRead::sread)
seqtabL <- getSequenceTableNoChime(MA)
seqtabL <- seqtabL[unlist(lapply(seqtabL, function(x) all(dim(x)>0)))]
SbyS <- lapply(colnames(MA), function(sampl){
sbys <- lapply(seqtabL, function(ST) {
sampl.here <- sampl[sampl%in%base::rownames(ST)]
cn <- base::colnames(ST)[which(ST[sampl.here,]>0)]
split <- strsplit(cn, "NNNNNNNNNN")
unlist(lapply(split, "[[", 1))
## it might be necessary to also track the counts here
})
sbys[!unlist(lapply(sbys, is.null))]
})
names(SbyS) <- colnames(MA)
SbyS <- SbyS[intersect(names(SbyS), names(RbyS))]
RbyS <- RbyS[intersect(names(SbyS), names(RbyS))]
sapply(names(SbyS), function (na) {
unlist(SbyS[[na]]) %in% unique(as.vector(RbyS[[na]]))
})
}
## Map the reads
map <- mapReadsStratTab(MA6)
## and execute the testing
expect_true(all(unlist(lapply(map, all))))
expect_true(any(unlist(lapply(map, length))>0))
})
context("Subsetting MultiAmplicon objects")
subRows <- 3:4
subRnames <- rownames(MA6)[subRows]
subCols <- 2:5
subCnames <- colnames(MA6)[subCols]
test_that("subsetting leaves stuff intact", {
expect_equal(getRawCounts(MA6[subRows, subCols]),
getRawCounts(MA6)[subRnames, subCnames, drop=FALSE])
expect_equal(getStratifiedFiles(MA6[subRows, subCols]),
getStratifiedFiles(MA6[subRnames, subCnames, drop=FALSE]))
## ## need to reimplement the pairedDada stuff!!
## expect_equal(getDadaF(MA6[subRows, subCnames]),
## getDadaF(MA6[subRnames, subCols]))
## ## DISCREPANCY!
## MA6@dada
## MA6[1, which(colnames(MA6)%in%"S04_F_filt.fastq.gz")]@dada
## MA6[1, colnames(MA6)%in%"S04_F_filt.fastq.gz"]@dada
## MA6[1, "S04_F_filt.fastq.gz"]@dada
expect_equal(getSequenceTable(MA6[2, 6]), getSequenceTable(MA6[2, 6, drop=FALSE]))
expect_equal(getSequenceTableNoChime(MA6[2, 6]),
getSequenceTableNoChime(MA6[2, 6, drop=FALSE]))
})
### THIS analyses SAMPLE CONFUSION caused by resorting before dada
MA1res <- MA1[, c(8, 6, 7, 1, 2, 3, 5)]
resortedMAdadaDerep <- dadaMulti(MA1res,
selfConsist=TRUE, pool=FALSE, multithread=TRUE)
## in all other steps resorting does not produce an error
resortedMA4 <- mergeMulti(resortedMAdadaDerep, justConcatenate=TRUE, maxMismatch = c(15, 20, 18))
resortedMA5 <- makeSequenceTableMulti(resortedMA4)
resortedMA6 <- removeChimeraMulti(resortedMA5)
################# EVALUATE sorting #############
test_that("Resorting produces identical output over samples", {
seqtabs <- getSequenceTableNoChime(MA6)
sorttabs <- getSequenceTableNoChime(resortedMA6)
SamSums <- lapply(seqtabs, rowSums)
SortSums <- lapply(sorttabs, rowSums)
samorder <- colnames(MA6)
## over samples
confusion <- lapply(names(SamSums), function(name) {
d <- cbind(SamSums[[name]][samorder], SortSums[[name]][samorder])
rownames(d) <- samorder
colnames(d) <- c("Correct", "Shuffle")
as.data.frame(d)
})
conf <- do.call(rbind, confusion)
expect_equal(conf[, "Correct"], conf[, "Shuffle"])
})
context("Concatenating MultiAmplicon objects")
MAcat <- concatenateMultiAmplicon(MA6[, 1:4],
MA6[, 5:8])
## ## FIX ME!!! Work on concatenation!
### There's something completely wrong when subsetting (and
### concatenating) sequence tables
### Fixing the sample naming problem first!!!
test_that("concatenating leaves stuff intact", {
expect_equal(getRawCounts(MA6), getRawCounts(MAcat))
expect_equal(getStratifiedFilesF(MA6), getStratifiedFilesF(MAcat))
## ## need to reimplement the pairedDada stuff!!
## expect_equal(getDadaF(MA6[subRows, subCnames]),
## getDadaF(MA6[subRnames, subCols]))
expect_equal(getSequenceTable(MA6), getSequenceTable(MAcat))
expect_equal(getSequenceTableNoChime(MA6),
getSequenceTableNoChime(MAcat))
})
## ## a solution would be a final push to make statified files a
## ## matrix probably!!!?
## test_that("Concatenating over samples works", {
## expect_equal(concatenateMultiAmplicon(MA[, 1:4], MA[, 5:8]),
## MA)
## })
context("adding sample information to MA objects")
additionalSD <- data.frame(whatever=letters[seq(ncol(MA6))],
row.names=rownames(MA6@sampleData))
test_that("sample data with exact matches of rowname works", {
expect_s4_class(addSampleData(MA, additionalSD), "MultiAmplicon")
})
additionalSD <- data.frame(whatever=letters[seq(ncol(MA6)+2)],
row.names=c(rownames(MA6@sampleData), "foo", "bar"))
test_that("sample data warning when more samples than sequence data", {
expect_warning(addSampleData(MA, additionalSD),
"sampleData but have no sequence data reported\\. They will be omitted")
})
additionalSD <- data.frame(whatever=letters[1:4],
row.names=rownames(MA6@sampleData)[1:4])
test_that("sample data warning when more sequence data than sample data", {
expect_warning(addSampleData(MA, additionalSD),
"missing from your sampleData but seem to have sequence data reported")
})
context("Handing over to Phyloseq")
test_that("toPhyloseq multi2Single TRUE/FALSE work and give same resultsw ", {
PHYWO <- toPhyloseq(MA6, samples=colnames(MA6))
PHYWO.list <- toPhyloseq(MA6, samples=colnames(MA6), multi2Single=FALSE)
expect_s4_class(PHYWO, "phyloseq")
expect_true(all(unlist(lapply(PHYWO.list, class))%in%c("phyloseq", "NULL")))
PHYWO.list <- PHYWO.list[!unlist(lapply(PHYWO.list, is.null))]
all.samplesL <- lapply(PHYWO.list, function (x) rownames(otu_table(x)))
all.samples <- rownames(otu_table(PHYWO))
lapply(all.samplesL, function (x) expect_equal(x, all.samples))
all.seqL <- unname(unlist(lapply(PHYWO.list, function (x) colnames(otu_table(x)))))
all.seq <- colnames(otu_table(PHYWO))
expect_equal(all.seqL, all.seq)
})
context("Get the pipeline summary")
test_that("pipelin Summary is a data.frame", {
expect_s3_class(getPipelineSummary(MA6), "data.frame")
expect_s3_class(getPipelineSummary(MAdadaDerep), "data.frame")
})
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.