Description Usage Arguments Value Author(s) Examples
Utility function that return the complimentary sequence of transcript RNA of input DNA sequence. This function will validate the DNA sequence.
1 | DNA2RNA(DNA.Seq)
|
DNA.Seq |
A deoxyribonucleic acid sequence |
Return the complementary sequence of DNA.Seq's transcript RNA
Sijie Xu, sijie.xu@mail.utoronto.ca
1 | (RNA <- DNA2RNA("TGGGATGAGGTGGATGTTTCCTA"))
|
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.