get3pAlignment: Finds 3' complementary binding of a miRNA

In ETHZ-INS/scanMiR: scanMiR

Finds 3' complementary binding of a miRNA

Description

Performs a local alignment of the miRNA 3' sequence (determined by 'mir3p.start') on given the given sequences.

Usage

get3pAlignment(
  seqs,
  mirseq,
  mir3p.start = 9L,
  allow.mismatch = TRUE,
  maxMirLoop = 7L,
  maxTargetLoop = 9L,
  maxLoopDiff = 4L,
  TGsub = TRUE,
  siteType = NULL
)

Arguments

seqs	A set of sequences in which to look for 3' matches (i.e. upstream of the seed match)
mirseq	The sequence of the mature miRNA
mir3p.start	The position in 'mirseq' in which to start looking
allow.mismatch	Logical; whether to allow mismatches
maxMirLoop	Maximum miRNA loop size
maxTargetLoop	Maximum target loop size
maxLoopDiff	Maximum size difference between miRNA and target loops
TGsub	Logical; whether to allow T/G substitutions.
siteType	The optional type of seed-complementarity, as returned by getMatchTypes. This is needed to identify slicing/TDMD sites. If given, should be a vector of the same length as 'seqs'.

Value

A data.frame with one row for each element of 'seqs', indicating the size of the miRNA bulge, the size of the target mRNA bulge, the number of mismatches at the 3' end, and the partial 3' alignment score (i.e. roughly the number of consecutive matching nucleotides)

Examples

get3pAlignment(seqs="NNAGTGTGCCATNN", mirseq="TGGAGTGTGACAATGGTGTTTG")

ETHZ-INS/scanMiR documentation built on July 17, 2024, 6:18 a.m.