tests/testthat/test-codonTable.R

library(coRdon)
context("codonTable class")

m <- matrix(sample(10:20, 128, replace = TRUE), ncol = 64)
df <- as.data.frame(m)

# string1 div. by 3
string1 <- "ATGGATTTTGGATTCTGTGACCTTCACAAACAGGCGTTGCCGGGCAAAAAGGCTTTG"
# string2 div. by 3
string2 <- "ATGCATGCAGTTGACCAGCTGTGACCTTCACACCGGGCAAAAAGGCTTGCATTGATAACG"
# string3 not div. by 3
string3 <- "ATGGCGGGTATGACCATGCAGTTGACCAGCACCCACCATAATTTGCCTCATGGTAT"
# empty
string4 <- ""

dna1 <- Biostrings::DNAStringSet(string1)
dna2 <- Biostrings::DNAStringSet(string2)
dna3 <- Biostrings::DNAStringSet(string3)
dna123 <- Biostrings::DNAStringSet(c(string1,string2, string3))
dna124 <- Biostrings::DNAStringSet(c(string1, string2, string4))
dna <- Biostrings::DNAStringSet(c(string1,string2))

test_that("accessing codonTable works", {
    expect_message(codonTable(m), "alphabetically sorted codons")
    expect_equal(length(codonTable(m)), nrow(m))
    expect_equal(length(codonTable(rbind(m[1,]))), 1)
    expect_equal(length(codonTable(df)), nrow(df))
    expect_warning(codonTable(dna3), "not divisible by 3")
    expect_warning(codonTable(dna123), "not divisible by 3")
    expect_warning(codonTable(dna124), "Length")
    expect_equal(getlen(codonTable(dna)), Biostrings::width(dna) %/% 3)
})

dna <- Biostrings::DNAStringSet(c(string1,string2, string1))
ct <- codonTable(dna)
ct <- setKO(ct, c("K00001", "K00002", "K00001"))
ct <- setCOG(ct, c("COG00001", "COG00002", "COG00001"))

test_that("subsetting codonTable works", {
    expect_equal(ct[1],ct[[1]])
    expect_equal(ct[1:2], head(ct,2))
    expect_equal(ct[length(ct)], tail(ct,1))
    expect_equal(subset(ct, c(TRUE,FALSE,TRUE)), subset(ct, "K00001"))
    expect_equal(subset(ct, c(TRUE,FALSE,TRUE)), subset(ct, "COG00001"))
})

Try the coRdon package in your browser

Any scripts or data that you put into this service are public.

coRdon documentation built on Nov. 8, 2020, 5:28 p.m.