plotTopMotifsSequence-MotifEnrichmentResults-method: Plot the top N enrichment motifs in a single sequence
In PWMEnrich: PWM enrichment analysis

Plot the top N enrichment motifs in a single sequence

1 2	## S4 method for signature 'MotifEnrichmentResults' plotTopMotifsSequence(obj, seq.id, n, bg = TRUE, id = FALSE, ...)

`obj`	a MotifEnrichmentResults object
`seq.id`	either the sequence number or sequence name
`n`	the number of top ranked motifs to plot
`bg`	if to use background corrected P-values to do the ranking (if available)
`id`	if to show PWM IDs instead of target TF names
`...`	other parameters passed to `plotMultipleMotifs()`

if(requireNamespace("PWMEnrich.Dmelanogaster.background")){
   ###
   # load the pre-compiled lognormal background
   data(PWMLogn.dm3.MotifDb.Dmel, package = "PWMEnrich.Dmelanogaster.background")

   # scan two sequences for motif enrichment
   sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), 
     DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))

   res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel)

   # plot the top 4 motifs in a 2x2 grid
   plotTopMotifsSequence(res, 1, 4)

   # plot top 3 motifs in a single row
   plotTopMotifsSequence(res, 1, 3, row=1, cols=3)
}