simulateDigestion: Simulate the digestion of a genome
In Basic4Cseq: Basic4Cseq: an R/Bioconductor package for analyzing 4C-seq data

Description Usage Arguments Details Value Note Author(s) Examples

This function simulates the digestion process with two restriction enzymes for a dna sequence or a BSgenome package. The information can then be used for quality controls of the biological fragment library.

1	simulateDigestion(firstCutter, secondCutter, dnaSequence)

`firstCutter`	First restriction enzyme sequence for the digestion process
`secondCutter`	Second restriction enzyme sequence for the digestion process
`dnaSequence`	DNA sequence that is digested

The resulting virtual library of fragment parts does not provide information on blind or non-blind fragments, but provides information on the fragment length distribution of the real (i.e. biological) 4C-seq library. In contrast to the regular virtual fragment library for 4C-seq data, fragments between two adjacent secondary restriction enzyme sites are counted as well.

Data frame with lengths and corresponding frequences of fragments

The resulting fragment lengths and corresponding frequencies can easily be visualized with R's plot function or the small convenience function drawDigestionFragmentHistogram
The resulting table of fragment frequencies can easily be exported with R's write.table function

Carolin Walter

1
2
3

    shortTestGenome = "ATCCATGTAGGCTAAGTACACATGTTAAGGTACAGTACAATTGCACGATCAT"
    fragments = simulateDigestion("catg", "gtac", shortTestGenome)
    head(fragments)