library(BiocStyle) knitr::opts_chunk$set(tidy=FALSE, cache=FALSE, dev="png", message=FALSE, error=FALSE, warning=TRUE)
Lorena Pantano - Harvard TH Chan School of Public Health, Boston, US
Georgia Escaramis - CIBERESP (CIBER Epidemiologia y Salud Publica)
miRNAs are small RNA fragments (18-23 nt long) that influence gene expression during development and cell stability. Morin et al [@morin], discovered isomiRs first time after sequencing human stem cells.
IsomiRs are miRNAs that vary slightly in sequence, which result from variations in the cleavage site during miRNA biogenesis (5’-trimming and 3’-trimming variants), nucleotide additions to the 3’-end of the mature miRNA (3’-addition variants) and nucleotide modifications (substitution variants)[@emarti].
There are many tools designed for isomiR detection, however the majority are
web application where user can not control the analysis. The two main command
tools for isomiRs mapping are SeqBuster and sRNAbench [@barturen2014]. r Biocpkg("isomiRs")
.
package is designed to analyze the output of SeqBuster tool or any other
tool after converting to the desire format.
If you use the package, please cite this paper [@isomirs].
The input should be the output of SeqBuster-miraligner tool (*.mirna files). It is compatible with mirTOP tool as well, which parses BAM files with alignments against miRNA precursors.
For each sample the file should have the following format:
seq name freq mir start end mism add t5 t3 TGTAAACATCCTACACTCAGCT seq_100014_x23 23 hsa-miR-30b-5p 17 40 0 0 0 GT TGTAAACATCCCTGACTGGAA seq_100019_x4 4 hsa-miR-30d-5p 6 26 13TC 0 0 g TGTAAACATCCCTGACTGGAA seq_100019_x4 4 hsa-miR-30e-5p 17 37 12CT 0 0 g CAAATTCGTATCTAGGGGATT seq_100049_x1 1 hsa-miR-10a-3p 63 81 0 TT 0 ata TGACCTAGGAATTGACAGCCAGT seq_100060_x1 1 hsa-miR-192-5p 25 47 8GT 0 c agt
This is the standard output of SeqBuster-miraligner tool, but can be converted from any other tool having the mapping information on the precursors. Read more on miraligner manual.
This object will store all raw data from the input files and some processed
information used for visualization and statistical analysis. It is a subclass of SummarizedExperiment
with colData
and counts
methods.
Beside that, the object contains
raw and normalized counts from miraligner allowing to update the summarization of miRNA expression.
The user can access the normalized count matrix with counts(object, norm=TRUE)
.
You can browse for the same miRNA or isomiRs in all samples with isoSelect
method.
library(isomiRs) data(mirData) head(isoSelect(mirData, mirna="hsa-let-7a-5p", 1000))
metadata(mirData)
contains two lists: rawList
is a list with same
length than number of samples and stores the input files
for each sample; isoList
is a list with same length than
number of samples and stores information for each isomiR type summarizing
the different changes for the different isomiRs (trimming at 3',
trimming a 5', addition and substitution). For instance, you can get
the data stored in isoList
for sample 1 and 5' changes
with this code metadata(ids)[["isoList"]][[1]]["t5sum"]
.
IsomiR names follows this structure:
iso
if the sequence has variations.
t5 tag: indicates variations at 5' position. The naming contains two words: direction - nucleotides
, where direction can be UPPER CASE NT (changes upstream of the 5' reference position) or LOWER CASE NT (changes downstream of the 5' reference position). 0
indicates no variation, meaning the 5' position is the same as the reference. After direction
, it follows the nucleotide/s that are added (for upstream changes) or deleted (for downstream changes).
t3 tag: indicates variations at 3' position. The naming contains two words: direction - nucleotides
, where direction can be LOWER CASE NT (upstream of the 3' reference position) or UPPER CASE NT (downstream of the 3' reference position). 0
indicates no variation, meaning the 3' position is the same as the reference. After direction
, it follows the nucleotide/s that are added (for downstream changes) or deleted (for upstream chanes).
ad tag: indicates nucleotides additions at 3' position. The naming contains two words: direction - nucleotides
, where direction is UPPER CASE NT (upstream of the 5' reference position). 0
indicates no variation, meaning the 3' position has no additions. After direction
, it follows the nucleotide/s that are added.
mm tag: indicates nucleotides substitutions along the sequences. The naming contains three words: position-nucleotideATsequence-nucleotideATreference
.
*seed tag: same as mm
tag, but only if the change happens between nucleotide 2 and 8.In general nucleotides in UPPER case mean insertions respect to the reference sequence, and nucleotides in LOWER case mean deletions respect to the reference sequence.
We are going to use a small RNAseq data from human brain samples [@pantano2016] to give some basic examples of isomiRs analyses.
In this data set we will find two groups:
pc: 7 control individuals pt: 7 patients with Parkinson's Disease in early stage.
library(isomiRs) data(mirData)
The function IsomirDataSeqFromFiles
needs a vector with the paths for each file
and a data frame with the design experiment similar to the one used for
a mRNA differential expression analysis. Row names of the data frame should
be the names for each sample in the same order than the list of files.
ids <- IsomirDataSeqFromFiles(fn_list, design=de)
You can plot isomiRs expression with isoPlot
. In this figure you
will see how abundant is each type of isomiRs at different positions
considering the total abundance and the total number of sequences.
The type
parameter controls what type of isomiRs to show. It can be
trimming (iso5 and iso3), addition (add) or substitution (subs) changes.
ids <- isoCounts(mirData) isoPlot(ids, type="all")
isoCounts
gets the count matrix that can be used for many
different downstream analyses changing the way isomiRs are collapsed. The
following command will merge all isomiRs into one feature: the reference
miRNA.
head(counts(ids))
The normalization uses rlog
from r Biocpkg("DESeq2")
package and
allows quick integration to another analyses like heatmap, clustering or PCA.
library(pheatmap) ids = isoNorm(ids, formula = ~ condition) pheatmap(counts(ids, norm=TRUE)[1:100,], annotation_col = data.frame(colData(ids)[,1,drop=FALSE]), show_rownames = FALSE, scale="row")
To get a detail description for each isomiR, the function
isoAnnotate
can return the naming, sequence and
importance value for each sample and isomiR. The importance
is calculated by:
$$importance = \frac{isomiR_reads}{miRNA_reads}$$
The columns are:
position:nt_ref:nt_isomiR
.head(isoAnnotate(ids))
The isoDE
uses functions from r Biocpkg("DESeq2")
package.
This function has parameters to create a matrix using only the reference
miRNAs, all isomiRs, or some of them.
This matrix and the design matrix are the inputs for DESeq2. The output
will be a DESeqDataSet object, allowing to generate any plot or table
explained in DESeq2 package vignette.
dds <- isoDE(ids, formula=~condition) library(DESeq2) plotMA(dds) head(results(dds, format="DataFrame"))
You can differentiate between reference sequences and isomiRs at 5' end with this command:
dds = isoDE(ids, formula=~condition, ref=TRUE, iso5=TRUE) head(results(dds, tidy=TRUE))
Alternative, for more complicated cases or if you want to control
more the differential expression analysis paramters you can use
directly r Biocpkg("DESeq2")
package feeding it with the output of
counts(ids)
and colData(ids)
like this:
dds = DESeqDataSetFromMatrix(counts(ids), colData(ids), design = ~condition)
The package offers a correlation analysis of miRNA and gene expression data.
Having two SummarizedExperiments objects with their expression, the target
prediction for each miRNA, the function isoNetwork
and isoPlotNetwork
can
generate a summarized figure showing the relationship between expression
profile, miRNA repression and enrichment analysis:
# library(org.Mm.eg.db) # library(clusterProfiler) data(isoExample) # ego <- enrichGO(row.names(assay(gene_ex_rse, "norm")), # org.Mm.eg.db, "ENSEMBL", ont = "BP") data = isoNetwork(mirna_ex_rse, gene_ex_rse, target = ma_ex, enrich = ego, summarize = "group") isoPlotNet(data, minGenes = 4)
As an option, org
can be org.Mm.eg.db
and genename
can be
ENSEMBL
and it will run enrcihGO
internally.
To create the ma_ex matrix, the user can use findTargets
:
mirna_ma <- data.frame(gene = names(gene_ex_rse)[1:20], mir = names(mirna_ex_rse)) ma_ex <- findTargets(mirna_ex_rse, gene_ex_rse, mirna_ma) head(ma_ex[,1:4])
And to get the mirna_ma
data.frame with the miRNA-target information,
the user can use mirna2targetscan
function:
library(targetscan.Hs.eg.db) mirna_ma <- mirna2targetscan(c("hsa-miR-34c-5p")) head(mirna_ma)
Here is the output of sessionInfo
on the system on which
this document was compiled:
sessionInfo()
Add the following code to your website.
For more information on customizing the embed code, read Embedding Snippets.