In ipb-halle/GoldenMutagenesis: A tool to calculate and validate primers for Golden Gate Cloning

knitr::opts_chunk$set(echo = TRUE)
knitr::opts_chunk$set(tidy.opts=list(width.cutoff=60),tidy=TRUE)

Multiple Site Saturation Mutagenesis -- Active site

You can find the lastest version of this file at https://github.com/ipb-halle/GoldenMutagenesis/blob/master/vignettes/MSD.md

Experimental Workflow

Target sequence

open reading frame YfeX in pCA24N (Chloramphenicol resistance)

Clone into

seperate gene fragments into pAGM9121 first\ then reassemble into pAGM22082_cRed

Genomic sequence YfeX

ATGTCTCAGGTTCAGAGTGGCATTTTGCCAGAACATTGCCGCGCGGCGATTTGGATCGAAGCCAACGTGAAAGGGGAAGTTGACGCCCTGCGTGCGGCCAGTAAAACATTTGCCGACAAACTGGCAACTTTTGAAGCGAAATTCCCGGACGCGCATCTTGGTGCGGTGGTTGCCTTTGGTAACAACACCTGGCGCGCTCTGAGCGGCGGCGTTGGGGCAGAAGAGCTGAAAGATTTTCCGGGCTACGGTAAAGGCCTTGCGCCGACGACCCAGTTCGATGTGTTGATCCACATTCTTTCTCTGCGTCACGACGTAAACTTCTCTGTCGCCCAGGCGGCGATGGAAGCCTTTGGTGACTGCATTGAAGTGAAAGAAGAGATCCACGGCTTCCGTTGGGTTGAAGAGCGTGACCTGAGCGGCTTTGTTGACGGTACGGAAAACCCGGCGGGTGAAGAGACGCGTCGCGAAGTGGCGGTTATCAAAGACGGCGTGGATGCGGGCGGCAGCTATGTGTTTGTCCAGCGTTGGGAACACAACCTGAAGCAGCTCAACCGGATGAGCGTTCACGATCAGGAGATGGTGATCGGGCGCACCAAAGAGGCCAACGAAGAGATCGACGGCGACGAACGTCCGGAAACCTCTCACCTCACCCGCGTTGATCTGAAAGAAGATGGCAAAGGGCTGAAGATTGTTCGCCAGAGCCTGCCGTACGGCACTGCCAGTGGCACTCACGGTCTGTACTTCTGCGCCTACTGCGCGCGTCTGCATAACATTGAGCAGCAACTGCTGAGCATGTTTGGCGATACCGATGGTAAGCGTGATGCGATGTTGCGTTTCACCAAACCGGTAACCGGCGGCTATTATTTCGCACCGTCGCTGGACAAGTTGATGGCGCTGTAA

Restriction Enzyme

Level 0

BbsI

Recognition site: GAAGAC

Level 2

BsaI

Recognition site: GGTCTC

Envisioned Mutations

Aspartic Acid - 137\ Aspartic Acid - 143\ Asparagine - 147\ Arginine - 232\ Serine - 234\ \ Substitute for NDT

R Workflow

library("GoldenMutagenesis")

input_sequence<-"ATGTCTCAGGTTCAGAGTGGCATTTTGCCAGAACATTGCCGCGCGGCGATTTGGATCGAAGCCAACGTGAAAGGGGAAGTTGACGCCCTGCGTGCGGCCAGTAAAACATTTGCCGACAAACTGGCAACTTTTGAAGCGAAATTCCCGGACGCGCATCTTGGTGCGGTGGTTGCCTTTGGTAACAACACCTGGCGCGCTCTGAGCGGCGGCGTTGGGGCAGAAGAGCTGAAAGATTTTCCGGGCTACGGTAAAGGCCTTGCGCCGACGACCCAGTTCGATGTGTTGATCCACATTCTTTCTCTGCGTCACGACGTAAACTTCTCTGTCGCCCAGGCGGCGATGGAAGCCTTTGGTGACTGCATTGAAGTGAAAGAAGAGATCCACGGCTTCCGTTGGGTTGAAGAGCGTGACCTGAGCGGCTTTGTTGACGGTACGGAAAACCCGGCGGGTGAAGAGACGCGTCGCGAAGTGGCGGTTATCAAAGACGGCGTGGATGCGGGCGGCAGCTATGTGTTTGTCCAGCGTTGGGAACACAACCTGAAGCAGCTCAACCGGATGAGCGTTCACGATCAGGAGATGGTGATCGGGCGCACCAAAGAGGCCAACGAAGAGATCGACGGCGACGAACGTCCGGAAACCTCTCACCTCACCCGCGTTGATCTGAAAGAAGATGGCAAAGGGCTGAAGATTGTTCGCCAGAGCCTGCCGTACGGCACTGCCAGTGGCACTCACGGTCTGTACTTCTGCGCCTACTGCGCGCGTCTGCATAACATTGAGCAGCAACTGCTGAGCATGTTTGGCGATACCGATGGTAAGCGTGATGCGATGTTGCGTTTCACCAAACCGGTAACCGGCGGCTATTATTTCGCACCGTCGCTGGACAAGTTGATGGCGCTGTAA"
recognition_site_bbsi<-"GAAGAC"
recognition_site_bsai<-"GGTCTC"
cuf<-"e_coli_316407.csv"

The domesticate function checks for internal cleavage sites. If corresponding sites are present silent mutations are introduced to destroy the recognition sites. The functions returns a list containing the position of the choosen amino acid residue for silent mutation.

mutations_bbsi<-domesticate(input_sequence, recognition_site_bbsi, cuf=cuf)
mutations_bbsi
mutations_bsai<-domesticate(input_sequence, recognition_site_bsai, cuf=cuf)
mutations_bsai

The mutate_msd function designs the necessary set of primers for the desired mutations.\ \ The function has the following parameters:\ prefix: Additional nucleobases in 5' position of the recognition site [default: TT]\ restriction_enzym: Recognition site sequence of the respective restriction enzyme [default: GGTCTC]\ codon: The codon which should be used in the mutagenesis [default: NDT]\ suffix: Spacer nucleotides matching the cleavage pattern of the enzyme [default: A]\ vector: Four basepair overhangs complementary to the created overhangs in the acceptor vector [default: c("AATG", "AAGC")]\ replacements: The desired substitutions as a vector with positions OR a list containing vetors with position (char) and type of MSD mutation (char) (see MSD3.rd for an example)\ binding_min_length: The minimal threshold value of the template binding sequence in amino acid residues [default: 4]\ binding_max_length: Maximal length of the binding sequence [default: 9]\ target_temp: Melting temperature of the binding sequence in °C [default: 60]\ replacement_range: Maximum distance between two randomization sites to be incoporated into a single primer in amino acid residues [default: 5]\ fragment_min_size: Minimal size of a generated gene fragment in base pairs [default 100]\ \ It will return an object of the class Primerset.\ The primers for multiple site saturation mutagenesis have an additional slot called "NDT". This slot contains a non-binding region in which (the) NDT site(s) is/are located.

#If domestication is necessary follow the workflow of the Point Mutagenesis vignette
mutations<-c(137,143,147,232,234)
primers<-mutate_msd(input_sequence, prefix="TT" ,restriction_enzyme=recognition_site_bsai, suffix="A", vector=c("AATG", "AAGC"), replacements=mutations, replacement_range=5, binding_min_length=4 ,binding_max_length = 9, target_temp=60, fragment_min_size=60 )
primers

The primers are generated for direct cloning into the Level 2 vector.\ The function primer_add_level modifies the primers for individual cloning into Level 0 vectors and subsequent assembly in Level 2.\ The parameters prefix, restriction_enzyme, suffix and vector can be set similar to the mutate-function.

primers_lvl0<-primer_add_level(primers,  prefix="TT", restriction_enzyme=recognition_site_bbsi, suffix="AA", vector=c("CTCA", "CTCG"))
primers_lvl0

Objects of the classes "Primer", "Primer MSD" and "Primerset" can have a slim textual output by using the function print_primer.

print_primer(primers_lvl0)

The textual output can be printed into a file.

sink("primers.txt", append=FALSE, split=FALSE)
print_primer(primers_lvl0)
sink()

ipb-halle/GoldenMutagenesis documentation built on Sept. 1, 2020, 3:24 p.m.